Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RIE1
Systematic Name YGR250C
Alias WHI8
Strain S288c
Description RNA binding protein and negative regulator of START; binds mRNA of the G1 cyclin CLN3 to stress granules for translational repression under conditions of stress; recruits the cyclin-dependent protein kinase Cdc28p to stress granules when stressful conditions are relieved, resulting in the dissolution of the granules, and resumption of translation; localizes to stress granules induced by glucose deprivation; protein abundance increases in response to DNA replication stress
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RIE1 YGR250C
TGTGGATTACGTCCGAAGGAATTGAACTTCCCAAGAGTAATGTGTACGGGACTGATCGAA
ATTCTCTCTTTTTCCTTAGAGCGTCTTTCTGCAGATCGCCACTACTATTCCTAGCGGAAG
AAACAAAAGAACGAAAAAAAAAACACTAGCCTATGCAAAGGGGAATATAATCATATGGGA
ATACAAGGATTGTAGTACTTGCATATTGTTCCGGCCCAACCCATTTCAAGATCCAACTAC
TTCATGGTAGGAAGCACAGTTTTTACATTCCCGAGAAGCAGCGCCCGCTTATTGCCCCGA
TAGAAGCAAAAACACCGCAACTCGTGGTTACGGGGTAAGAAACCGAAAATTATTTAATCA
TCTACGGGGCTACGCTTTTACATAATCTCTAGAGTATTCTAGAGAATTGAGATGATTTAT
GTCTTTTCCCGGCTAACATGCAAGTAGAATGCGGATAAGCCTCATGGAGCGTGGTTGATT
AATCGACACTCTCGGTATTCTCTTGTGTACGTACGATGTTTCTCCCGCTGATCCGATTAC
TAGCCGAAGACGTAAAATTGGCGCTTGATTCAATTTATGCCCTTCCCGGGAATAGTTGAC
CAAAGGGCAAAAAAATTCAGTCGGAGATTCCCTATTGGGCGGAATTTAGTAGATCTCTTT
CCGTGCATAACGCCTGCCCGTTAGTCGTTATTTCACGTTAACATTTTCTTGGCCACTGCG
CTATATAAATAAATACATATATATATGTCAAGCACAATAAAGAAACTTCCCTTAAATATT
GAATAAGTAAATAATAGTTGAAAAGTGCCTTTTGTTCGAAGGATTAGAGTGTTCTTAATT
TTAGTTCGTTCAACGGTCTCAAAAAAAGTGTGAACAAGTAAAGCATAGCACACATCCCAA
ATTACAAGGCACCCTGATTAAAAATCCAAAAATAAACCATAAGTTTTATTTTACTAAAAA
CATTATACGTGAAAGACAAACCGCATCAGAAGTTTCGAGG
Chr coordinates Chr VII from 993521-991176
w3c xhtml validator w3c css validator