Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RIE1
Systematic Name YGR250C
Strain S288c
Description Putative RNA binding protein; localizes to stress granules induced by glucose deprivation; interacts with Rbg1p in a two-hybrid
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RIE1 YGR250C
TGTGGATTACGTCCGAAGGAATTGAACTTCCCAAGAGTAATGTGTACGGGACTGATCGAA
ATTCTCTCTTTTTCCTTAGAGCGTCTTTCTGCAGATCGCCACTACTATTCCTAGCGGAAG
AAACAAAAGAACGAAAAAAAAAACACTAGCCTATGCAAAGGGGAATATAATCATATGGGA
ATACAAGGATTGTAGTACTTGCATATTGTTCCGGCCCAACCCATTTCAAGATCCAACTAC
TTCATGGTAGGAAGCACAGTTTTTACATTCCCGAGAAGCAGCGCCCGCTTATTGCCCCGA
TAGAAGCAAAAACACCGCAACTCGTGGTTACGGGGTAAGAAACCGAAAATTATTTAATCA
TCTACGGGGCTACGCTTTTACATAATCTCTAGAGTATTCTAGAGAATTGAGATGATTTAT
GTCTTTTCCCGGCTAACATGCAAGTAGAATGCGGATAAGCCTCATGGAGCGTGGTTGATT
AATCGACACTCTCGGTATTCTCTTGTGTACGTACGATGTTTCTCCCGCTGATCCGATTAC
TAGCCGAAGACGTAAAATTGGCGCTTGATTCAATTTATGCCCTTCCCGGGAATAGTTGAC
CAAAGGGCAAAAAAATTCAGTCGGAGATTCCCTATTGGGCGGAATTTAGTAGATCTCTTT
CCGTGCATAACGCCTGCCCGTTAGTCGTTATTTCACGTTAACATTTTCTTGGCCACTGCG
CTATATAAATAAATACATATATATATGTCAAGCACAATAAAGAAACTTCCCTTAAATATT
GAATAAGTAAATAATAGTTGAAAAGTGCCTTTTGTTCGAAGGATTAGAGTGTTCTTAATT
TTAGTTCGTTCAACGGTCTCAAAAAAAGTGTGAACAAGTAAAGCATAGCACACATCCCAA
ATTACAAGGCACCCTGATTAAAAATCCAAAAATAAACCATAAGTTTTATTTTACTAAAAA
CATTATACGTGAAAGACAAACCGCATCAGAAGTTTCGAGG
Chr coordinates Chr VII from 993521-991176
w3c xhtml validator w3c css validator