Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RIE1
Systematic Name YGR250C
Alias WHI8
Strain S288c
Description RNA binding protein and negative regulator of START; binds mRNA of the G1 cyclin CLN3 to stress granules for translational repression under conditions of stress; recruits the cyclin-dependent protein kinase Cdc28p to stress granules when stressful conditions are relieved, resulting in the dissolution of the granules, and resumption of translation; localizes to stress granules induced by glucose deprivation; protein abundance increases in response to DNA replication stress
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
Hide Seq
>RIE1 YGR250C
ATGAATATTGCAGAAGAACCATCAGATGAAGTAATATCTAGTGGCCCCGAGGATACAGAT
ATCTGCAGCCAGCAGACATCAGCGAGCGCAGAAGCTGGAGACCAATCAATAAAAATTGAA
AGGAAAACTTCCACTGGTCTTCAACTGGAACAATTGGCCAACACAAATTTATTAACCATA
AGAATAAAATGGCAGTTACAAGAAGAAGAAGATGATCACTGCAACTCTAGAATAACCGAT
CAAATAATGGACACAATACAGCACTACAAAGGTATCTCCGTTAACAACTCTGATACAGAA
ACATATGAATTTCTTCCGGATACAAGGAGGTTACAGGTTCTCGAACAAAATAAAGACATC
TATCTTTACGAGCATGGAAGTCAAGAGTATGAGAAATCTTACAAAGATAACGAAGAGGAA
GATGATTGGAGATACGATACCGTTTTGCAAGCACAATTCAAGTACCCCAAGTCATTAGAA
AATGCATGTACAGATATCTCGGAATTACTCAAGAGCGAACCTATTGGTCAGCATATTGAT
AAATGGTCTATCGGTGTGAACAAGCATGCACTAACCTATCCTGGAAATATTTTTGTCGGG
GGAATAGCAAAGAGCCTTTCTATTGGTGAACTAAGTTTCTTATTTTCAAAATATGGACCA
ATTTTATCAATGAAATTGATATATGATAAAACGAAAGGCGAACCTAACGGATACGGGTTC
ATCTCCTACCCCTTGGGTTCTCAAGCTTCACTTTGCATCAAGGAACTTAATGGAAGGACG
GTAAATGGCTCCACACTATTTATCAACTATCACGTTGAGCGAAAGGAGAGAGAAAGAATC
CATTGGGACCATGTCAAAGAAAACAACAATGATGATAATTTCAGGTGTCTCTTTATAGGC
AACTTGCCTTATCACAATCCTGAAAAAGTAGAGACTTTGATTACACCTAAAGAAGTCATA
GAAGTAATCAAGAAGGAGTTATCAAAAAAGTTTCCGGACTTTGATATCATTTCATATTAC
TTTCCGAAGAGAAGTAATACAAGAAGCAGTAGTTCAGTAAGTTTCAATGAGGAGGGGTCA
GTAGAATCAAACAAATCTTCCAATAATACTAATGGAAATGCCCAAGATGAAGATATGTTG
AAGGGTTATGGTTTCATCAAGCTTATCAACCATGAACAAGCACTAGCAGCCATCGAGACC
TTCAATGGGTTCATGTGGCATGGAAACAGGCTCGTTGTTAATAAGGCGGTTCAACATAAA
GTTTACAACAACCACAATAGCCATGACAGGCACCCTTCCATCAGTAACCACAATGATATG
GAGGTTTTGGAATTTGCAAATAACCCAATGTATGATTACAATAATTATACATATGATAGA
TATTACTTCAACAATAATAAAAACGGGAACAGCAACGATACCTCCAATGTACGGTATTTT
GATTCTGTAAGATCAACCCCTGTGGCAGAGAAAATGGATCTGTTCTATCCTCAAAGGGAA
TCTTTCAGTGAAGGTCGTGGTCAACGTGTGCCTAGATTCATGGGCAACAAGTTTGACATG
TACCAGTACCCATCAACTTCTTACAGCTTACCTATACCAATGAGTAATCAGCAAGAATCA
AACCTATATGTCAAGCACATCCCTCTTTCTTGGACAGATGAAGATTTATATGATTTCTAC
AAATCTTTCGGTGAAATAATCAGCGTTAAGGTCATTACTGTTGGGGGTAGTAAGAACAAG
TATCGTCAACAATCGAATGATAGCTCATCAGATAATGATCTGCCAGTGGGATCATCAAGA
GGTTATGGTTTTGTTTCTTTTGAAAGCCCATTAGATGCTGCTAAGGCAATTTTGAATACA
GACGGGTATCAAGTGAGCAAAGATCAAGTGTTATCTGTTTCTTTCGCTCAGAAACGTGGT
AATTTATCTTCAAGTGATGATGATGATCAATCCCAAACTGATAACTCATCAAAGTTCCAA
AATTTTCAGCCACATAATGATTATCATAAGGCTTATCCAACAAAGTATAATAAGAAATTT
ATCAATGCCTTGATGACTCAGAACCAATCGCAACAGCAAGTCTCGAGGGAAAATTATTTC
ATACCACTGCAGTACCCTAATACCAACACAAAGCCCGTGAACAGTTACAACTTAATAAGT
GCAAACCAAAATAACGCTAACTGGATGATGCCAATGTTCCCATCATTTGGGTTTATTCCA
CAGGTGCCGCCAGTGCCCTATATAATACCTCCGCAGAATCCTGCAGCAAATCATATTCCT
ATAATGGCAAACGGTAGTAATGAAGAGGAAGAATTTTCTAGTGGTGATTATTCTATGGAC
TACTAG
Promoter Sequence
Download FASTA
>RIE1 YGR250C
TGTGGATTACGTCCGAAGGAATTGAACTTCCCAAGAGTAATGTGTACGGGACTGATCGAA
ATTCTCTCTTTTTCCTTAGAGCGTCTTTCTGCAGATCGCCACTACTATTCCTAGCGGAAG
AAACAAAAGAACGAAAAAAAAAACACTAGCCTATGCAAAGGGGAATATAATCATATGGGA
ATACAAGGATTGTAGTACTTGCATATTGTTCCGGCCCAACCCATTTCAAGATCCAACTAC
TTCATGGTAGGAAGCACAGTTTTTACATTCCCGAGAAGCAGCGCCCGCTTATTGCCCCGA
TAGAAGCAAAAACACCGCAACTCGTGGTTACGGGGTAAGAAACCGAAAATTATTTAATCA
TCTACGGGGCTACGCTTTTACATAATCTCTAGAGTATTCTAGAGAATTGAGATGATTTAT
GTCTTTTCCCGGCTAACATGCAAGTAGAATGCGGATAAGCCTCATGGAGCGTGGTTGATT
AATCGACACTCTCGGTATTCTCTTGTGTACGTACGATGTTTCTCCCGCTGATCCGATTAC
TAGCCGAAGACGTAAAATTGGCGCTTGATTCAATTTATGCCCTTCCCGGGAATAGTTGAC
CAAAGGGCAAAAAAATTCAGTCGGAGATTCCCTATTGGGCGGAATTTAGTAGATCTCTTT
CCGTGCATAACGCCTGCCCGTTAGTCGTTATTTCACGTTAACATTTTCTTGGCCACTGCG
CTATATAAATAAATACATATATATATGTCAAGCACAATAAAGAAACTTCCCTTAAATATT
GAATAAGTAAATAATAGTTGAAAAGTGCCTTTTGTTCGAAGGATTAGAGTGTTCTTAATT
TTAGTTCGTTCAACGGTCTCAAAAAAAGTGTGAACAAGTAAAGCATAGCACACATCCCAA
ATTACAAGGCACCCTGATTAAAAATCCAAAAATAAACCATAAGTTTTATTTTACTAAAAA
CATTATACGTGAAAGACAAACCGCATCAGAAGTTTCGAGG
Chr coordinates Chr VII from 993521-991176
w3c xhtml validator w3c css validator