Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PUP2
Systematic Name YGR253C
Alias DOA5
Strain S288c
Description Alpha 5 subunit of the 20S proteasome; involved in ubiquitin-dependent catabolism; human homolog is subunit zeta
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PUP2 YGR253C
CATCTGACTAGTGGTAACTCTAGACGGCTTCGATGCAGAGAGTTCCTCAAAATTTTTCTT
TTCAATTGTTTGCCTGGTTTCCGCGGCGTATATCAGTTTTTGGCGATATGGTAACGCGAT
ACTCTACGGCACCTTCACGGTAGATGTCTTTTTTAAAAGTGACTGTTAATTCCAGGATTG
AAAGGAAGTGTCGAATAGTATAGTATGCTTTCTACACTTATAGTACACTACTAGGTGTAT
CAGATCAATTGGCCCTTGATAAAAAGCGCTGAGGAAGGAAGGATTCCTATTTTGACATAG
CTTTCAATATAGGGCCATTTATATCCATGTTATATATACAATATACTTATGTGTCAATTA
TTAGAATTGTTGAAGACATTTGTAGGTGAGAAAGTTTCTTGTTTGTCGAGAAGAATTTGA
GTCATAATCTTTATATCAAATAACTCTGGATAAGTGCTGTGCATTTCAATAACATGTTGT
AATTACTATATATTAATGAAGATAAAAGCTCAGGTTCATCGCATGTGGCGCTATAATGCT
TTTTATTTGATAATGTTCCACTTGTATTTTTTTTTTTTTTTAAAAAAATTATCTTTTTTT
ATAAAGTATGTGAGAAAGAAATAACAAAACATGAACTTTTTTCAAGAATAATGTAGCCCA
AAAAGTAAAAAAGGACACTTTTGCAACTACTGCTGAAGACTTTTTACTGAAATGAATTGA
CTATCAAACATATTATAAGCCAAGCATAGATGAAAGTACGCCGATTTTTTATTAAGCGTG
CAAACATGAATGTAGCCCAAGTCCGTAAGGATAATTTAGTGCTTAAATTAAATAAATCAC
TATTCACGAAAATATTTTTGAAATTTCATTATACAGGGTTATCATAAACCAAGACCGGTG
GCAAAAGAGTAACCTAGGAAATTGGACAAGAGAGCGCTATAACTATAGAATACAAGTCAA
TAAGAACATAAATTCCAATTGTCTAATATAACTAGAAAGG
Chr coordinates Chr VII from 999140-998358
w3c xhtml validator w3c css validator