Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ENO1
Systematic Name YGR254W
Alias HSP48
Strain S288c
Description Enolase I, a phosphopyruvate hydratase that catalyzes the conversion of 2-phosphoglycerate to phosphoenolpyruvate during glycolysis and the reverse reaction during gluconeogenesis; expression is repressed in response to glucose
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ENO1 YGR254W
TAGAAAGCATACTATACTATTCGACACTTCCTTTCAATCCTGGAATTAACAGTCACTTTT
AAAAAAGACATCTACCGTGAAGGTGCCGTAGAGTATCGCGTTACCATATCGCCAAAAACT
GATATACGCCGCGGAAACCAGGCAAACAATTGAAAAGAAAAATTTTGAGGAACTCTCTGC
ATCGAAGCCGTCTAGAGTTACCACTAGTCAGATGCCGCGGGCACTTGAGCACCTCATGCA
CAGCAATAACACAACACAATGGTTAGTAGCAACCTGAATTCGGTCATTGATGCATGCATG
TGCCGTGAAGCGGGACAACCAGAAAAGTCGTCTATAAATGCCGGCACGTGCGATCATCGT
GGCGGGGTTTTAAGAGTGCATATCACAAATTGTCGCATTACCGCGGAACCGCCAGATATT
CATTACTTGACGCAAAAGCGTTTGAAATAATGACGAAAAAGAAGGAAGAAAAAAAAAGAA
AAATACCGCTTCTAGGCGGGTTATCTACTGATCCGAGCTTCCACTAGGATAGCACCCAAA
CACCTGCATATTTGGACGACCTTTACTTACACCACCAAAAACCACTTTCGCCTCTCCCGC
CCCTGATAACGTCCACTAATTGAGCGATTACCTGAGCGGTCCTCTTTTGTTTGCAGCATG
AGACTTGCATACTGCAAATCGTAAGTAGCAACGTCTCAAGGTCAAAACTGTATGGAAACC
TTGTCACCTCACTTAATTCTAGCTAGCCTACCCTGCAAGTCAAGAGGTCTCCGTGATTCC
TAGCCACCTCAAGGTATGCCTCTCCCCGGAAACTGTGGCCTTTTCTGGCACACATGATCT
CCACGATTTCAACATATAAATAGCTTTTGATAATGGCAATATTAATCAAATTTATTTTAC
TTCTTTCTTGTAACATCTCTCTTGTAATCCCTTATTCCTTCTAGCTATTTTTCATAAAAA
ACCAAGCAACTGCTTATCAACACACAAACACTAAATCAAA
Chr coordinates Chr VII from 1000927-1002240
w3c xhtml validator w3c css validator