Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name GND2
Systematic Name YGR256W
Strain S288c
Description 6-phosphogluconate dehydrogenase (decarboxylating), catalyzes an NADPH regenerating reaction in the pentose phosphate pathway; required for growth on D-glucono-delta-lactone
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GND2 YGR256W
TCCGTCATAACTTTGAATCCTGTCATGCATCAAAGTTGCCCCAGCGTTATTCTCAAGAAA
ATGAATAGATCTAGGCGTAACACTGACAATCCTGTTCGTAAAATAATCTGGGGGTGAATT
ATAAAAGTCCGATAATTTATCTTTTAAGTCCACCATATCGACTAAAGTTGTCTTTAGATC
TTTTAATTGCGGAGAATTCTTAATCGATGCAGCTAAAGTCAAACCTGCAGGACCCCCACC
TACGATTAATACATCTGTTAACTTTGGAGCTGAAGATTTGGCTGTTGCCAAACCCCTCAC
CAAAATACGCCGAGTAAGCATAACTTTTGAAAAGAACATGCCTCTGTGTCAATCGATACA
AGGTTCACTGAAAGACCAATTTGAGTTACTGAATGAAGAAAATTATCGCCACAATTATAT
TTATTCCTTTTTAATGTCGTATCACAATTCCAGAAGGGATATTTCTCAGAAACAGTTTAA
GATCTGCGTGTTCCTTCTGCAAGAAGAAGGGAAAAAAAGAAAGGAGAAACAATAGCAGCA
TAAATCTTGTTCGATAAAACAACATCACTTTTTCTTGAAACTTCAAGGGTTTGCCTCCTT
AGCTTAGTGGTAGAGCGTTGCACTTGTAATGCAAAGGTCGTTAGTTCAATTCTGACAGGT
GGCAGTTTCCTTTTTATTTGTCAGTATTAATAATTGAGGCGCCCCTAATTTTTTTGGCAC
CGCTCTCGATGAAAAAGTAGAGACGTCAGAAATTGAACGTTTCCTCTAGGAGTTTATTAA
CTAATAACCCCGAAAAATGGCTCTTTAACCACGAGTGCCCACGGAGGTTATCTTCACCCC
TATTTTCATTTTAAATTTTAGATCACTGCTAGGAGTTAGCTCAAATATATATATATATAT
ATATATGGAGACAACGTTTGAAGAATTCGTAGGTGCAGGTGAGCATATTGCCGGATAAGT
GTAGTTACGCAACTACAATTAAAAAAACACGAGGAACAGA
Chr coordinates Chr VII from 1004624-1006102
w3c xhtml validator w3c css validator