Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YGR273C
Systematic Name YGR273C
Strain S288c
Description Putative protein of unknown function; expression downregulated by treatment with 8-methoxypsoralen plus UVA irradiation; not an essential gene; YGR273C has a paralog, YMR295C, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YGR273C YGR273C
GAAGATGTTAACAAATTGTTAGAGGAGGACACTTCAAAGATAAATAACTTGGAAGAACTT
GAGAAACAGAAAAAACTGTTGCAACTAGAATTAGCTAATTTGGAAAAATCACAGCAACGT
AGAGCAGCAAGGCAAAATTCGAAGAGAAATGGTGGTGCCACGAGAACAGAAAACTCTGTG
GATAATGGTAGCGACCTTGCCGGTGTAACTGACGGGAAAGCAGCCAGGAATAAAGGTAAG
AACACTACAAGGAGATGTGCTACATGCGGACAAATCGGGCACATTAGAACAAATAAATCT
TGTCCAATGTATAGCAGTAAAGATAACCCTGCTTCACCAAAGTAGATTCAGTATAACGAT
GTATTGATCGAATAAAACTTTTGTAAAGGTTTTGTATAATGTAACAATAAAGAAATGTAC
ACTATGTTTCTAAACACTGGCAGTGATCAGATTGATAATTTATTGAGTCATATCCTTAAA
CGATGGACGTGGTGTGTGAATGTGCACTTTTGCAGTAAGATGAAAAGTGCATATTATTTG
AGTTCCATTAATATAGCCCAACTCACTGATTAAACACAATAATTGTTGTCTTTGTGCTCG
AGTATTTAAAGCTTGTATTTTTCCAGTCTGATTGGAAATCACAGAGGTTAAAACATAAAG
GACAATAGCAGAAAAGGTTCCCTAATATGCATTTTTCATACTGGTTGCTCTTTTCCTTTA
CAAAAGCAAATTCTTACTCAAAATTTAATCTTTTTCCCTATAGTAACCTGTTTGTCTTGA
TAAATATAATATGATTTATGTAGTTTTATTACTATAATTATATCAAAATTTTAATTTGTG
TCTATTTTTTCCTCAACTAAGTTACCTTTTTTCATTTATATGCATTTGTGACGCACTCAA
AAGTGTGATGCTGTCGTCAATTTTATAATGTTAAGAATATTAAAGCAAAAGTTTCCTAAA
GTAATATCTGAAGTGCTCTAAAATCATAGTTTATCAAAAA
Chr coordinates Chr VII from 1039239-1038715
w3c xhtml validator w3c css validator