Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CAB4
Systematic Name YGR277C
Strain S288c
Description Probable pantetheine-phosphate adenylyltransferase (PPAT), which catalyzes the fourth step in the biosynthesis of coenzyme A from pantothenate; null mutant lethality is complemented by E. coli coaD (encoding PPAT); widely conserved
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CAB4 YGR277C
TTGACTGTTACTACCTTCATTTGTGTCGGACGTATTATTTATCAGCAGCTTCTGTCGTAG
CGTATCAAACGCCATGGTTAGTTCATTGAAATTTTCACACTTTTCAAAATTTCCCAGTTC
TTTGTTGGCTTCATCCTCATCACTAACAATATAGGAGTGCGTATGAACTGTGTAACTAGT
TGGGTCCAATATAAACAGACCTTGAGACCCAGATTTATAATCTTTTTGCCTTATTTCAAA
CAGAGTCTCTAACGACTCACGTAGTGTACTAGATAACTCCTGTGTTTGCAAAATATATCT
TAACTTCTCCCAAATCATATCATGGGTTTTCTTACTGACAAGTGCAAGTTTCCAGCCACA
TATTTTCATCACGGCAATGACCAGTCGTAAAGAATTCTTTTCAAGGAGTAGCAATAGAAT
CTGTAAGATCACGATTTCATGAATTACATCATAAAGAAATAAAATGGACAGACATTGAAG
GATATTTCCGCAGGACACGTAATCTTTGCGATTGAATTGCTGCACGAACATTAACATTAG
TTCTTTTGCTAAAGTTTCTCCAATATCTGGAATATCAGAATTTAGCAAGGCAATCAAAGC
GGATAAAGCAGGGATTAGCCTGCCATTCTGTTTGTTCAGAGTAAAATCCACAACATTTTT
ACAAATTATGTTGCGGCCAATAAGTATATTGACTTGAAATAAGTCTCTGTGCGATTCCTG
TAAGTTGTCCATTGTTAAATTGGATATTATGGGTGAAACGTGTGACCTTATCATTTCCCA
GTTTTCTCTCTGAAATTTAATGTCTTCATCCTGTATGGTAGCGGTAGACATGCTGGTTTG
TAGCCTTTTTATTCCTTTTTAGGTTTCTTACTCACAATGCCAAAATAAATATCAGTGTAA
TATAATTTTTCAAGAGTACGTAATGGAAAAAGATAAAAATAAGGACCGTCATAAAAAGAG
ACGTGATTAAACCTAAAAATCTAAAGTAAAGAAGTGTAAG
Chr coordinates Chr VII from 1046561-1045644
w3c xhtml validator w3c css validator