Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YGR283C
Systematic Name YGR283C
Strain S288c
Description Protein of unknown function; may interact with ribosomes, based on co-purification experiments; predicted to be involved in ribosome biogenesis; null mutant is resistant to fluconazole; GFP-fusion protein localizes to the nucleolus
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YGR283C YGR283C
AGACAACATTCGGTATGCTTCCTGAATTAAACAGCAAAAACGACAAAGCGAAGGGTTACC
TGTTGTTTGCTGGTAGAATTTTAATTGTTTTAATGTTTATCGCTTTCACTTTCAGTAAAT
CATGGTTTACTGTTGTTTTGACCATTATCGGCACAATATGTTTCGCCATTGGTTACAAGA
CAAAATTCGCATCCATTATGTTGGGTTTGATACTAACTTTTTACAATATCACGCTAAACA
ACTACTGGTTTTATAACAATACTAAGAGAGATTTCTTGAAGTATGAGTTTTACCAGAACT
TAAGCATCATTGGTGGGCTTCTATTAGTTACTAATACTGGCGCTGGTGAATTATCCGTTG
ATGAAAAGAAGAAGATTTACTAGATTGTAAAGGAAATCTTTTCTTTATGTCCCTTCTGTT
CACTCATCTTCTAACAATCTATTTCGTTTTGCCTTCTTGTGATCGCTTTCAATACCCTGC
TAGCTCACATATATACTTTTCTTACTGTCATATCTACATAAAAGATTTCTTTTTGTATAG
GCGCACTTAACGAAATTTGATTGGTCTCACGTTGGCTTGTATATTCTACCTTCAATCAAT
GTGGTTATATCGCACAGAATTCCCTTGTATTATGATAGAACTTATTTATTGTAATTAGTT
TTGATTTGACCATTTTCGTTGGTCCGTAATTGTTTTACACTGTCACTGCTTAAATCATTG
AAGAGATGCTCTTGAGATAGCATCCGCTCTCCTATCTTTCCAAAGAAACGCTTTAAAGTC
GCTTTAAGCAATCTCTAAAGTTTAAAAATTCCTAATAAATAGCTCTTTAGCAACTATTGT
AAACCGCAATAATGGGCACACCCAAACATATTATTTGAAATTTTTTCCACCTCATCGCTT
GAAAACACCATGTTGAAATTGGGATATTAAGTAGAGGAGGTAATTGATACCAATGAGGTG
AAACACATCTACCAAGGGAAGTGTAGCATAATAGGGGAAG
Chr coordinates Chr VII from 1060040-1059015
w3c xhtml validator w3c css validator