Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ZUO1
Systematic Name YGR285C
Alias zuotin
Strain S288c
Description Ribosome-associated chaperone, functions in ribosome biogenesis and, in partnership with Ssz1p and SSb1/2, as a chaperone for nascent polypeptide chains; contains a DnaJ domain and functions as a J-protein partner for Ssb1p and Ssb2p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ZUO1 YGR285C
ATCCTGAGTCCCTACCAATTAATAGACTAGTTGCTATCAAAGGGACTCCAATGGCTGAGG
AACTTGCCGATCCAAAGAGTAAAAAGTTGCAATTCGACGAAATTTTGAGAACCATTGCCA
CAGCGAGAATAGTTATGCCAAAGGCCATTATAAGACTTGCCGCTGGTCGTTATACAATGA
AAGAAACAGAGCAATTTGTCTGTTTCATGGCAGGTTGTAACAGTATCTTCACCGGTAAGA
AAATGCTGACGACAATGTGTAACGGTTGGGACGAAGACAAGGCAATGTTGGCTAAATGGG
GATTGCAACCTATGGAGGCATTTAAGTACGACAGATCTTGAAGATAGGGATATGTGGATA
ATTCTACGATTCTAACTGTACATTTCTCCCTTATTTATTAAGAAAACCTATATATATATA
TATTTACCTATTTATTCTGCCATCGTTAGCTGGCGTTTTATCTTTTATGCATCCAATATC
TAATATTACTTCCGATCACGCATTTAGTTCTGATTACAGCAGAAATCGTAGCGCGATGAG
ACATTTCATCAAATGGCCTTTTTTTTTTGGGCAATTTTTTTATATCTTGAAATGATAGTT
GCCTTGTACTTTCAACCGTTCATTTCATTAAGAACTTGACTAAATATGAACATTTCTTAA
AAAAAAGGTTGACATATAAAAATAATCGAATATAAACGATGGAATTTTTATAAAATTAAA
CACATATATATATATATATTAACTATAAATATGTCAAAGAAACCATACAATCATAGATTT
ATAACTATCTTTTGGATGACATTAATGAACATAACGCTCCTAATACAAATGTCCAAAAAA
TATTACCCGCAAATACGAATCTTTTTTTTTTCTCGATGAAATTTTGCAAAGAGTTCGAAA
TTTTTATTTCAAGAGCTGGTAGAGAAAATTTCATAAGGTTTTCCTACCGATGCTTTTATA
AAATCTTCGTTTTGTCTCACATATACCAACAAGAGTAACG
Chr coordinates Chr VII from 1063153-1061852
w3c xhtml validator w3c css validator