Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name BIO2
Systematic Name YGR286C
Strain S288c
Description Biotin synthase, catalyzes the conversion of dethiobiotin to biotin, which is the last step of the biotin biosynthesis pathway; complements E. coli bioB mutant
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>BIO2 YGR286C
CTTCGAATAACAACAGCAAGAGGCTCTAGGATGAAGTCTTCCCGGAAACCATTACTCCAA
AGTAGGTAGCTGTGGAAAGCAGCTTCCAGATAATAGTAAATGGATAACCGTTTCTAAGCG
ACCTTATTTCAGTCTTGAAAATACTTACCCATTTTGCATCGATTGGGAACTGAGAACCTA
CAAGCCGTAAGATTGCGTAGCTTTCTCTTGGGGTCCGTGAGATCCGTATTCTGCATTATT
ACTGCATCTCCAACGAAACTACCTCATTGTGTGAAACTACTATTTCTTGCAAGAAGTTAT
GACTGCGATGCAAATTACAAAATATACAATTGTAAAACGGCTTAATAGAAAGACATTAGT
AGCCCTTGGTCATTACCTTCATATTCAAATAAGCTAATGATCAAATAAAAAAGCCCAACG
ATATTGCCTGTTGCATCTAAAATTTTCCAAGTCAAACGAGTTCATATTATATACTATGTA
TGGAATATATATATATAATTTTTCATTTTATTTTCAAAAAATGCCACTGCGCAAATCTCT
GTCCATCAGTACTGTTCTTTACAATTTTATCGTGGGAAGTTGCGGAGGGGCGTGTTGGCT
AGCAAAAGATAGTCATGTCGAGATGACTCGCGGATGAAGTCTCGCGTCTTCTTCGAAGCC
ATTTTGCCGGCATTTGGTTATGGAAAAAAGTTGTTGAAAAGTGCAAAGCATTAGAACCGT
CCCTGTCACGCTGGTGCCCCCACAGATTTCACGTGAGAGACGATGCCTGAGGAAAATCCG
CTACGCTGCTGCCTAATCTGTATTTACAGGCTATGTAGTTCGTTTGCCACTCTGCTAGAT
TCTCTTGGTATCTTTTATTTCTTCTCTTAGGCAGATCTTATATAAAAGGGCAAAGCTTTT
TTTGCTCCCATACTTGCTGAAAATTTTTCAGATCTTACTCTTCTGGTAGTGGTGTCCTCA
GAAGAGCTAACTTAGCCGATTATTTTCAATTTAGTGCAGT
Chr coordinates Chr VII from 1064940-1063813
w3c xhtml validator w3c css validator