Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name IMA1
Systematic Name YGR287C
Strain S288c
Description Major isomaltase (alpha-1,6-glucosidase) required for isomaltose utilization; has specificity for isomaltose, palatinose, and methyl-alpha-glucoside; member of the IMA isomaltase family
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>IMA1 YGR287C
GGAACGGGGCTGTATGTTTATGATTGCTCGAATCACGTTTTTCTTGTTTTTTCGTCAAGA
ATTCCAGTCAAGTTTTCCACCACCTTGACCCTTAAAGCATCGACTTTTGTGCTCTTGAAT
GTGTTTCTAAGAATACTTGTAAAGGACACCCTCTAATTTCGTGTGCACTTTTCACATATT
ATCAAGACAATCGTTCCTGTACTCAGATGCACTGTTACTGTAAAGACTACTATACAACAA
GCGAAAAATGATGTTCGAAAACCTTTATTTCTATTTTGAAAGGCATGTGTCTCGAGGTCC
TTGCTTTATTGTGGGTGGTCATGCCATTCTGTAAACCTTACGGTACTGCTCCGTCTATAT
CTTTGAGGTTGTTATTTCCCCACAAATATGCGTTTCTAACCGAATATTCATTCAGTCGGA
CCGGACAATAGCTCTTAACTGCGTTTACCGGAGTAAATATCGTAAGAATTTGCATGCGGT
GAAATACAGGGAAAATAAGAAATTACACCCTAATACAAAAAGAAAACTAAGTTTCACAAT
ACGTAAGGATATTTTAGTGGGGAGAATATTTCGGAGAATAAAGTTTCCAACTCCGCGGTG
TGAACAACCGCTCAGCACGCAGCGTTATTCTCGAGAAAAGTGGCCCTGAAATAAGGAAAT
AAAGTTACTAATGTTTTTTCGCTGTACGATATCAAATGTGACGAAGTAGGCACCCCACGC
TATAAATTGGCTACTAAAGTTTATGTCAGTACTTGGGATCGTTGAAATACTCGGATAAAT
TATGTTCCTTATTTTTCATGGTTTTCGTCATACCACAGTTTACCCCAGAATGAGAAAGGA
TCTCCTTTTGAAATAAAAAGTACTTAAGGGCAATGATATTGAGTTGCTAGACGTTTGGTT
AGACGCCTGTTTTGAAATAAAAAAGCTGTCTCAAATTAATCGAGCAAGCACAGATCAAAC
AAGATACAAACAAAGCTTTTCAACGTAATATTTACTATCG
Chr coordinates Chr VII from 1068991-1067222
w3c xhtml validator w3c css validator