Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MAL12
Systematic Name YGR292W
Alias MALS
Strain S288c
Description Maltase (alpha-D-glucosidase), inducible protein involved in maltose catabolism; encoded in the MAL1 complex locus; hydrolyzes the disaccharides maltose, turanose, maltotriose, and sucrose
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MAL12 YGR292W
TCGTTATCTTCGTCAGAATCTCCTAACTGGGCTGAATTGGTGGTGAACTCTAAGTGGTCT
AGCTCAAAGGCACTATCCTTTTTCCCTTCTTCAAAATCTTCAGTATTGAAAACCTCCTGT
TGGTTTACAATATCTCTTGAAGACTCAGAAATGTTTTTATCCTCATTTTTTGAGGCAGCC
TTCTTCTTGCTTACCAATGAAATGATATTTTTCATATTATACTATTTTTTTAGTTGTTTG
ATGTTCTTCTATGTAGCATCAGAAAGAAACACCAACCCGAAAATTCTTCAAACAATCAAT
ACCAAACCGCTTTATATAAAAAATTAAGATGTCGACATTCCTTATTTTTTACTGAGTTCG
TTAAAGTTGGGTACACTCTTGATTACTGTAATTGTCTCTGTATGTCCCTCAAGCCCGGTA
CGTTGTCATTTTCTAGTACGCATCAACGGAGTGTTACATGATAGATAGACCGAGTAGAAT
CTATGGCTATGGGGTAATTAAAACCTTAAAGCTCCTTTCGCTGCCATAGTAATACGAATA
GACCTTGGCTATAGTAAGTTGCATCTGTACCGTAGAGATTCTTGCAACTCGCTTAAACTC
TCGCTTTTAGATAATATTTCTCCTTATTGCGCGCTTCGTTGAAAATTTCGCTAAACACGG
GGTTTAAGTTAAAGTTTACAGGATTTATCCGGAAATTTTCGCGGACCCCACACAATTAAG
AATTGGCTCGAAGAGTGATAACGCATACTTTTCTTTTCTTTTTTTAGTTCCTAGCGTACC
TAACGTAGGTAACATGATTTGGATCGTGGGATGATACAAACAACGTAAGATGAATAGTTC
CTTCCTCAATTCTTCTTGCAGCATCATTTTCTTGAGGCGCTCTGGGCAAGGTATAAAAAG
TTCCATTAATACGTCTCTAAAAAATTAAATCATCCATCTCTTAAGCAGTTTTTTTGATAA
TCTCAAATGTACATCAGTCAAGCGTAACTAAATTACATAA
Chr coordinates Chr VII from 1076599-1078353
w3c xhtml validator w3c css validator