Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MRP4
Systematic Name YHL004W
Alias uS2m
Strain S288c
Description Mitochondrial ribosomal protein of the small subunit
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MRP4 YHL004W
TTGGCCGTGTTTCGGGCCACGAGGCGAAAATTTTTTTTTTTTAATCGAAAAAAAAAGGAA
AAAAAGATTAACGTTTCTTTTTCGTTCTATCGTCTTCTACGATATCGCATGTAACACAAT
GCAGCTATCTGATAATATGGTCCCAGAATCGCAATAGCCGGGCAGGCACGCTACTAGAAG
GCGGTTCTGGATAGAATTCAACTTTAGATGGCAGACTGAGGCACTGCCGTAACACAAGGC
TAAGTAGCCGCAGCTGTTGCGGTCCATCTTGTGTCGCGGTGAGATCCCACAATCCATAGA
CGAGTACATTAGAGTATTGCGGACCATTCGCCTGCGCTTGCATCCGGGTGAGGTACATGT
ATAAGTACTTTACCCGGCCCAAAAAAACTACGGATACCCGCTCCCGGCTTGCCACGTGAC
CTGCCACAGTGTTCGTAGTCACGTGCTCCTTCAGTCCTCCTAACTCTACGTACTTCCTGG
CAGTGTCTCCAAGGACTATCACCAGTACGTTTGGGCTTGACTGATCCAGGCTCCAATCGC
TTTCTACTAGCTGTTGCAACCGCTCTTCAAACTGCATATTGTATCCTGCTGCTGCTGTTG
TTGCACCCGTTATTGCACCTGAGCATTAATATATGCGTATATGTATCTATCTATGTATAT
GTGTATGTGTAATATGTATACGTTTATGTTAATGCATAAACTGTAATGAAACGAATACTC
ACCCGCTTGCTCTCTCTCACGTATAACACACGCATACTGCCCTATTTTCCTGTTTATCTC
GGTAAGAAAAGGCCGTGCCGGGTCAGAAAAGAGTGCAAGAAAAAAATCAATTCGGTAAGT
GAATCCGAGAGATGAAATTTGTATGTCGTAGGTCACTGCTATATTTGATGGTAAATAATA
ATCAGTTCTGGCAAGTGTACATACGCTCGAGAGCCTGATTATCGCGGGGCACAAATACAG
GTGATTCGAGAAATAAAAAGTGAGAAACGACTCTTTTCTC
Chr coordinates Chr VIII from 99219-100403
w3c xhtml validator w3c css validator