Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YHL008C
Systematic Name YHL008C
Strain S288c
Description Putative protein of unknown function; may be involved in the uptake of chloride ions; does not appear to be involved in monocarboxylic acid transport; green fluorescent protein (GFP)-fusion protein localizes to the vacuole
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YHL008C YHL008C
GGGGAGCCTCCATATTTAAATGAAACCCCGCTAAGAGCACTGTATTTAATTGCTACAAAT
GGTACACCCAAGTTAAAGGAACCCGAGAATCTATCGTCAAGCTTGAAAAAATTCCTTGAT
TGGTGTTTATGTGTGGAGCCCGAAGATAGAGCAAGCGCTACGGAATTGCTTCATGATGAA
TATATCACGGAGATAGCTGAAGCCAATTCCTCATTGGCCCCGCTAGTCAAGTTAGCAAGA
TTGAAGAAAGTAGCTGAGAACATGGATGCTGATGAAGATAATGACGACGATAACGACAAC
GAGCATATTAATAAGACAAACAATTGTGACGACAATAACGATAGCAAAGAAACCGTAAAT
TTGGACGTAACTGAAGATGATAAACAAAAGTAAACGTAGCAAGCAGGGTACACCTTATTA
TCGACAAAGTATATACACAGTTGTGACTGGCATAAAAATTCTTTTCATATATCTTATCGT
GTATATTTGGACATTTTATAACACATCCCACTCTAATTCACAACTTCATTAACGAAATTT
AAATAAATCACGACAACAGTTTTGCTTAAAACTGAGGAATATTGAAACCAACTCAAATTC
TTCCTAATTTCAGGCGTATAAAAATAACAAAGTCTCATCGAGTGTCGGGTACCATTACAC
GAACATCTGTCTGCGTTCTATGTAACGAAGGAGAGGTATTATCCAATTTTGGAAATATCC
GTAATATTGTCCTTAGTGCACGAACTATATTATCCCGCAAATTCAGGGAAAAGAAAAGAA
GTAGAAAAAAAAAAATACCATGGGAGTCAGTTCTTGTTCAGCTGAGAGAATTACGCTTGT
TTCTTATTTCCCACATATACGAGAAATTCCTACCGATATAACATCCTCTCTCGTCTTCTA
GAATTTTCCAGTTGAGTGAAGTTTTTTATTTTCATAAACTAACAAGATTATTTCATGGAA
CAGTGACGGAAAGGATTTTCTAAAGGCATTGTTAGAAAAA
Chr coordinates Chr VIII from 94510-92627
w3c xhtml validator w3c css validator