Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RPS20
Systematic Name YHL015W
Alias S10, URP2, uS10
Strain S288c
Description Protein component of the small (40S) ribosomal subunit; overproduction suppresses mutations affecting RNA polymerase III-dependent transcription; has similarity to E. coli S10 and rat S20 ribosomal proteins
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPS20 YHL015W
ACATCTTGCCTGTTATCTAAGGATAACCGTACCGTAGAAAGCGCAATGATGAGTTACACC
TTTCCCATAGGTACGCCTGCTTGTTTCTATGCTGCAACTGACTATTGGCCTGTCCACTCT
CGAGCATTATTGTCTGTCGCATTTGCTATCATAAAATATCCCGATAAGATAACACCCAAA
TGTGCGCCGCCTCATTTCATCATCGGAAAAAAGGTGCGGCACCAATAGATAAACAGAATT
GGAATGCCTAGTTTGAGTCAGCCTTGCTGCATAAAACAAATACCTGTATGACTGCTTTTG
CATCTTTAAGAGAACCTTTGGTCTTGGCTAATCTCAAAATTAAAGTTCATATCTACCGTA
TGAAGCGCTGATAAAGAGCGCCAAATCTGCACCTTGTGCATTTTGTTCACACATTCTTGG
CGCTCCTAACTGGAGAAACGTCTATCATTGAGGATAACTCCGGATAGTCGCATTCTGATT
GAATAGCCGTCTAGCTCCCTATTGTGACTAGAATACTATTGACATCGTTTTCTCATCAAA
ACCTCCCGATAAAGGGAAAAAAAGAATTATCTGACCAGATCATTCGGAAAAATGCGTATC
GTCATTGATATCCTTCTTGTCTTGTCTGCTGCTAACACTATTTACTATGGAAAGAGAGAT
TTCCCTGAAACTTCTTATTTTTATCTCTATAGAAGGGGAAAAGATAAAAGTAAAAATGTA
AAAATGTTTACCTGCAAGTTCACACCTGTACATTTTCTACATCCGTAAACATAAGAGAAA
AAATGCCACAACTATTTTTATGAAGATAAAGTTCGGGTAACGATAATGTTTTAATTTTGA
AAAAAAAACTTCGACGCATTCGCGACTAGCCTCAGAGATTGAGTAATAGACCGTATTGAA
TTCAAAATAATAGTAAAGATGGGTTATTTCATTCAAGCTCAGCTTTAGATTGAAACTCCT
ACAAGAAAGCAAGTAAAATAAACAAAAAGGTATATACAAA
Chr coordinates Chr VIII from 75412-75777
w3c xhtml validator w3c css validator