Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name DUR3
Systematic Name YHL016C
Strain S288c
Description Plasma membrane transporter for both urea and polyamines, expression is highly sensitive to nitrogen catabolite repression and induced by allophanate, the last intermediate of the allantoin degradative pathway
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>DUR3 YHL016C
TAAAACATTATCGTTACCCGAACTTTATCTTCATAAAAATAGTTGTGGCATTTTTTCTCT
TATGTTTACGGATGTAGAAAATGTACAGGTGTGAACTTGCAGGTAAACATTTTTACATTT
TTACTTTTATCTTTTCCCCTTCTATAGAGATAAAAATAAGAAGTTTCAGGGAAATCTCTC
TTTCCATAGTAAATAGTGTTAGCAGCAGACAAGACAAGAAGGATATCAATGACGATACGC
ATTTTTCCGAATGATCTGGTCAGATAATTCTTTTTTTCCCTTTATCGGGAGGTTTTGATG
AGAAAACGATGTCAATAGTATTCTAGTCACAATAGGGAGCTAGACGGCTATTCAATCAGA
ATGCGACTATCCGGAGTTATCCTCAATGATAGACGTTTCTCCAGTTAGGAGCGCCAAGAA
TGTGTGAACAAAATGCACAAGGTGCAGATTTGGCGCTCTTTATCAGCGCTTCATACGGTA
GATATGAACTTTAATTTTGAGATTAGCCAAGACCAAAGGTTCTCTTAAAGATGCAAAAGC
AGTCATACAGGTATTTGTTTTATGCAGCAAGGCTGACTCAAACTAGGCATTCCAATTCTG
TTTATCTATTGGTGCCGCACCTTTTTTCCGATGATGAAATGAGGCGGCGCACATTTGGGT
GTTATCTTATCGGGATATTTTATGATAGCAAATGCGACAGACAATAATGCTCGAGAGTGG
ACAGGCCAATAGTCAGTTGCAGCATAGAAACAAGCAGGCGTACCTATGGGAAAGGTGTAA
CTCATCATTGCGCTTTCTACGGTACGGTTATCCTTAGATAACAGGCAAGATGTGCTCTAT
TCATCGGTGTTGCATGAAGATACGTCTTGTTCGCCAAGTATATAAAATGAAGCAGTAGTA
TAGCCGTAGCTTTACTATTGTTAGCAGTTTCCCTTGTCTAGATTCTTAAATTGGGTTCAT
CCAAGAAAAAGTAATAACATAAATTTGTCATTGTTATAGT
Chr coordinates Chr VIII from 74244-72037
w3c xhtml validator w3c css validator