Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name NPR3
Systematic Name YHL023C
Alias RMD11
Strain S288c
Description Subunit of the Iml1p/SEACIT complex; SEACIT (Iml1p-Npr2p-Npr3p) is a subcomplex of SEAC, a coatomer-related complex that associates dynamically with the vacuole; Npr3p may have a structural or regulatory role, supporting Iml1p function as a GAP for the Rag family GTPase Gtr1p, and leading to inhibition of TORC1 signaling in response to amino acid deprivation; SEACIT is required for non-nitrogen-starvation-induced autophagy; null mutant has meiotic defects; human NPRL3 homolog
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>NPR3 YHL023C
AAGCAAACAATTTTCCCTGGTAAGCCCTGTCTAATTCCATTTTTCCAAGATGATGCGGTC
ATCAAGTTAGGGACAACAAGTATGTGTAATATTGTAATAGTGGAAAAAGAAGCTGTCTTC
ACCAAATTAGTAAATAATTATCACAAGTTGAGTACAAATACCATGCTCATTACAGGTAAG
GGATTTCCAGATTTCTTGACAAGGTTATTCCTAAAAAAACTAGAACAATATTGCTCCAAA
TTGATATCGGACTGTTCTATATTTACCGATGCGGACCCCTATGGGATTAGCATAGCCCTA
AATTATACTCACTCGAATGAACGCAACGCTTATATTTGCACGATGGCAAACTATAAAGGA
ATTCGTATTACGCAAGTTTTGGCACAAAATAATGAAGTGCATAACAAATCCATTCAATTA
TTGAGTTTGAATCAGCGCGACTACTCCTTAGCCAAGAATTTGATAGCATCTCTGACTGCC
AACAGCTGGGATATTGCAACTTCACCATTAAAGAACGTCATCATAGAATGTCAGCGGGAA
ATTTTTTTCCAAAAGAAAGCTGAAATGAACGAGATTGATGCCAGAATTTTTGAATACAAA
TGAATAAGAATGGGAGCTGTTGCTTTATAAAAAATGTTTTTCAAGAATTGAAAACGGTTA
CATTTAAATATTATATAAATTGAAATCTTTGATAATGAATACTAGTCCAAAAAAAAATAC
AATTTCAAAAAAATAAATGCCATCTCCTAGAATCGAACCAGGGTTTCATCGGCCACAACG
ATGTGTACTAACCACTATACTAAGATGGCATATGATTTTACAATGATTCGATGGTGAATG
AGTTATAAGCCATGTAAGGATCACTAGTCTTTTTTCTTAAGTAACTTTTTCGCTTGTGAT
ATCTTGAAATACCATTAAACATAGATAAGCTATTGAAATGTGAAGAAAATTCAAAAAAAA
AAGGGAACAGAGTCATCTTTTGGGTAGAAACTAAGCTTCA
Chr coordinates Chr VIII from 62563-59123
w3c xhtml validator w3c css validator