Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RIM4
Systematic Name YHL024W
Strain S288c
Description Putative RNA-binding protein required for the expression of early and middle sporulation genes
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RIM4 YHL024W
CAGCAGCAAGATTTGCAGCAACAGCAACAAGTAGTGACTACAGTTGCCTCGCAAAGTCCT
CATGCAACTGCAACGGAAAAGGAGCCAGTACCCGCCGTGGTTGACGACCCACTGGAGAAC
ATGTTCGGAGATTATTCCAATGAGCCGTTCAACACCAATTTCGACGATGAATTTGGAGAT
CTTGATGCTGTATTTTTTTAATAGCCATGGGCGGCTACTTCTTGGAAATATATACTTTCC
TTTTACATATTTAGTATAGTTATACATGTGGATGTGTATGGAGGTAAGATCAGATAGACC
CTTCACTGTTTTCTGTGTATTCCTTGTGACATAGTGGATTTGTGCAGCTACTGCTTATAG
GAAGCAGTGCCTGCAAAACAATTCATTCGTTGGTTGATGTGGCGCGCTGACTGAATGTGT
AGGGTCTGTTGTTACCCCCTTGCTCCGGGGGCCCACATCTCTCTGACGCGAAGAAAGGCT
CGAGATGTGCCAGTCGTAAACACCGCCTCATTTCCCTTGCATTCTCCTCCAGTGAAAAAG
CAGTACGACCTATCTCCGAAAAAAAAAAACCTCCTGTGCGTTTACTGTGGATCATGCAAC
ACGATTTCTGTAGATTAAAGACGTTTTTGGCATGGACTAAGCTAAATTCCGTTTGATTAG
CCGCCCATAACGGGTGGCAAACAACACGATGAAACTCTATATCCCCGCTTAACGTTTCGG
CGGCTGTGATCAAGGAAAATAGTATATAAGTTCGTCGGATTTCTTATTTGTTTTCTCTCT
TCCTTTCTCTCTCCCTTTCTCGTGCTTGGTTGTTTTCCTTAATTAGTTAAAACAATAAAA
GAACAAGAAGGAGAAGGCGATTTTGGACTAGAAAATCACGAAGAAAAAATATCTAATTGC
ATTCCTATATATATTTATATACATACTCTCTATTGTTTGTTTTTTGCCTGCTCAAGAAGA
AAGAAAGAAAAAAATATTATCTTTTTTAGCTTGTTGAAAC
Chr coordinates Chr VIII from 56649-58790
w3c xhtml validator w3c css validator