Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RIM4
Systematic Name YHL024W
Strain S288c
Description Putative RNA-binding protein required for the expression of early and middle sporulation genes
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>RIM4 YHL024W
ATGAAAACCGAAATCAGCACTGCGGATTCCCTTCGTGATCCTCCCTCTAATGGTCTAAAG
GCCGACTCTGAGCTGGTTATCAGAGAGGATATAGACCAATTTTTGCCTTCGGAAGTATCT
TCGTTGGGGTCAGATCACCAGAATGATGGTGAGGATTCAGACACTGACAGTGACAACTTT
TTGCAAGACCCTGAAGACGATGTGGATGAAGAAAGCACTGGTAGAGGTACAGTCACTACC
ACTTCCACATCCACTGAGTCAAGAGGCCGTCCATCTTCTTGTATCTTCGTGGCAAGCTTA
GCAGCAGCCCTATCCGATGACGAATTATGTCTGTCGGTGACTGAAAATTTCAAAAAATAC
GGTGATTTGGCTAGAGTTAAAGTTTTGCGTGATAACGCAAATAGACCTTATGCTTTTGTT
CAATACAACAACGATCATGATGCTAAACATGCTCTGATCCGCGCTCAGGGTACTTTATTA
AATGGCAGAAGGTTGCGTTGTGAACCTGCAAAAGTGAACAGGACATTGTACTTGAAAAAC
CAGCAAAGTATTGATTTCAACGAGATCAGTCAAATTTGTGAAAAATTTGGTGGTTTGGAA
CAGATTGTTCCTGATAGAACTGATAATCAATACACGAGAAGATATACTTATCCGATATCT
TCGGCAAATTCTTGGTTTGTTCAATTCGTTTACAGAGACGATGCAATCAGAGCTTATGCG
AATTTACGAACTGATCCCAATTGGATCATCGAATGGGCACAAAATATAAACGTCCCAAAA
AATTATAACCTTTTACACAAAAGCAAATTCAAAAGTTCCAAATACCATCAAAACAACGGT
ATTATCAATAACGATGGTAGTAACAACAACGATAATAATAATAGTAATAATAATAATAGA
GAGGATTCAAGGAGGAATGGCGACGTTATAGAAGAGGAGTGCGGACATGTGCATGGTAGT
GATTCAGAGGAAAAATTGACAAGCGATGGTATTTATGACGACGAAGATAAAGATTCCGAG
ATCACCATTGATAAAAGATCCATTTTCGTGGGTCAATTAGACAAAGAAACCACCAGAGAG
GAATTGAATAGAAGATTTTCCACTCATGGTAAAATCCAAGATATTAATTTAATCTTCAAG
CCAACAAACATATTTGCGTTTATTAAATATGAAACCGAAGAAGCTGCTGCTGCTGCTTTG
GAAAGTGAAAACCATGCAATTTTTTTGAATAAGACAATGCATGTTCAATATAAAGAGGTA
GGTGGTCGTCACAACAGGAAGTTCTCTGGTAAGAACGGTGGCAGCAACTTTAACCATCAT
CAGTTTTTTAGCACCAGATCGGGCAAAACATTTACAGGGCCAGAACTGAACTTAGCACCA
CCACCAATCAACATGTACAGGAAAATGAGCGGCGGATCCCAGCAGGAAAGCGAAACTATG
ATGCCATACATGCCCATGGGGCCCATGCCCATGGGGCCTCCACCACCAAATGCAGCAAGT
CTCAGTGATTTTGATATGTTCCCCCCAAGTTACTCCACGTTTATGAAGGGAATGATGCCA
TTGAGGCGTAAATCTATGCCCAATTCTTGGTCATCCCCTTCTTCAAAGAGTGTGAACTCT
GAAAATGAAAGTGTTAATGGTGGTGATGAGAATTCCGAATTGCCTTCCGAAATTCCTGAA
TCATCTGGTAGATATAATGCTGCTAATTCCTTTACCACATATAATAATTCCTCAGCAGGA
AACTCTAACAACAACAACAACAACAACAACAGTAACAGTAATAAGTCTCAATATAAAAAG
CGCTATGCAAGGAGGTCAAGCTACGGATACAATGAAGTACCTCCAAAACCATACTATTTC
CAGCCTTATTACTATCACCCCATGCAATACCATATGGGCCCAATGGGCCCATTGCATCCT
TCTCAAGGTTCTGCTGGAAATCACCATCCATATATGATGGTTTATCCCATGTCACCACCT
CCGCCTTCTGGGTTAGATGGAAGCATGATCCCTCCTCCAATAAATGTAAGCCAATCACAT
GCTGCTAATCATGGCAGTACCCATGTTCATGCGAACGAATTCATATCAAACGATACTGGT
GACATAAATGAAGATAACAAAGCTTATAGTTTAGATTACTAA
Promoter Sequence
Download FASTA
>RIM4 YHL024W
CAGCAGCAAGATTTGCAGCAACAGCAACAAGTAGTGACTACAGTTGCCTCGCAAAGTCCT
CATGCAACTGCAACGGAAAAGGAGCCAGTACCCGCCGTGGTTGACGACCCACTGGAGAAC
ATGTTCGGAGATTATTCCAATGAGCCGTTCAACACCAATTTCGACGATGAATTTGGAGAT
CTTGATGCTGTATTTTTTTAATAGCCATGGGCGGCTACTTCTTGGAAATATATACTTTCC
TTTTACATATTTAGTATAGTTATACATGTGGATGTGTATGGAGGTAAGATCAGATAGACC
CTTCACTGTTTTCTGTGTATTCCTTGTGACATAGTGGATTTGTGCAGCTACTGCTTATAG
GAAGCAGTGCCTGCAAAACAATTCATTCGTTGGTTGATGTGGCGCGCTGACTGAATGTGT
AGGGTCTGTTGTTACCCCCTTGCTCCGGGGGCCCACATCTCTCTGACGCGAAGAAAGGCT
CGAGATGTGCCAGTCGTAAACACCGCCTCATTTCCCTTGCATTCTCCTCCAGTGAAAAAG
CAGTACGACCTATCTCCGAAAAAAAAAAACCTCCTGTGCGTTTACTGTGGATCATGCAAC
ACGATTTCTGTAGATTAAAGACGTTTTTGGCATGGACTAAGCTAAATTCCGTTTGATTAG
CCGCCCATAACGGGTGGCAAACAACACGATGAAACTCTATATCCCCGCTTAACGTTTCGG
CGGCTGTGATCAAGGAAAATAGTATATAAGTTCGTCGGATTTCTTATTTGTTTTCTCTCT
TCCTTTCTCTCTCCCTTTCTCGTGCTTGGTTGTTTTCCTTAATTAGTTAAAACAATAAAA
GAACAAGAAGGAGAAGGCGATTTTGGACTAGAAAATCACGAAGAAAAAATATCTAATTGC
ATTCCTATATATATTTATATACATACTCTCTATTGTTTGTTTTTTGCCTGCTCAAGAAGA
AAGAAAGAAAAAAATATTATCTTTTTTAGCTTGTTGAAAC
Chr coordinates Chr VIII from 56649-58790
w3c xhtml validator w3c css validator