Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name WSC4
Systematic Name YHL028W
Alias YFW1, YHC8
Strain S288c
Description Endoplasmic reticulum (ER) membrane protein; involved in the translocation of soluble secretory proteins and insertion of membrane proteins into the ER membrane; may also have a role in the stress response but has only partial functional overlap with WSC1-3
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>WSC4 YHL028W
ATTGGGTGGTACTTCAGCAGGATCGGCCACACGACGTGTCGCAACTGTGGTGGAACCCCG
TATGTTCTTGCTAAAAAGGCCAATGAGTCATGGTCATTGCACTTTACTAGATGGATAGTC
GTTTCGATAAGGTTCTTGTTGCGAAACTGCTGTTTTAGATTTTTCAAGTAGTGGGAATTC
GCCATGGGCGACTTCTTGTCGTGCATATTTGCTAGCGAGCCCTTTACCCTGTAACGTCTC
TAAGAAATTTCGAATAGTGATCTACAGGTACGTCTGAGCTATTATCAATTTCTACCAGGA
ATTTGAAGCTCCCACAGAATAGCTTCCAAGAAACCTGAAAAAAAAAAAAAATGAAAAATA
TGTATCATTCCTCACGAATGAGTCCATTGCTTTCCCGTCTCAAATGATTGAGAATATATC
GTATGATAACGTAAGAGTATTCAGTATCAACGGCAACAACAACAACAACAACAACAACAA
CAGCACAACAACAGCACAACAACATCGAACGGTTGCTACTGCGACGTTACGGATTATATC
CACAGTATATGGCGTGCAGCGATAAGGCTCGAGACACCGTTCTGTACGGACCTGACGTTG
ACTGTGAGACACAGACGGGGCCGCGGGAACCCTTAATGTGGTTCCCGGAACGGAATGAGT
ACGGTGAAAAAGGGAATCAGGAGGCACGGTACCTGCATATTGCGCCTTTTTTGGTTTCCC
CTTCGGGCAGCAAGTGTTTACTGTAGGATAATGGTACTATTACGGTATTTCCACTTTGGG
CGACGTTAAGATACGGGCATGAATTAAGGTAAGCAAATCCTTTTGTTGCAAACAGCAAGG
TCGTTATGTGTAAATATATATATATATGCGTTCTGTGCTAGTGTGATTTGCCCTGCTTCA
GGGGCGGGTGCAGTAGGGAGCTCATGACAGCAAGTACATTTTGTTTATTTTTTAAAAGGA
AAGAAAGGCTAGATACCTCGAATTACAAAACCAAAAACGC
Chr coordinates Chr VIII from 48763-50580
w3c xhtml validator w3c css validator