Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ECM29
Systematic Name YHL030W
Strain S288c
Description Scaffold protein that assists in association of the proteasome core particle with the regulatory particle; degraded by the mature proteasome after assembly; contains HEAT-like repeats
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ECM29 YHL030W
CAGCATCCCCTATAGGAGCTGGCGCGTCCGTTGTGGAATTAGCAATATCGTTCTTCACGC
TGAATAACAAGTTTAGTCTGTTGCGCTCTTGCTGGATGGAGGACCTGATATTGCGGAAGC
TCTTCCAGTGGTCTTGTAAGATCTCCTTGTGGCGGTGCAGTTGGGAAAGCTTTGAGGCGG
AGATTGCCGGGTTAGAATCGCAGATTTGTGTTAATGAATCGATTACATCCTGTCTCTGGC
CTAAGATTCCCTCCAACTGCTTGTCTATCTTCTTTTCTTGGCCAGTTTGTTCTGAACTAG
TTGTCTGCGCGAATGTGGAGTACTTGGAAAGAAGTGACTCCGTTTGTGTTTCTAGAGAAA
TGGCCTTGCCCCTTATGGTGACGAAAGACGGTTGTGAGCTCATGTGGTGTGGTTGCTTGT
CTGGAATTGGGCTTTTCCCTGTGTCTAGTTAGTTTATTTTTTCCTTGTCTTTTTATCTCT
TTTTTTTTGTTTTTCGTTCTCTTTATTTTCAACAACGCCTAGAAAATTTGGTTACCAACC
ACACTATTGAACAAAGATAACTAACTGATTGAACAAGAGTAGGCGTCTTACACTGGGTTT
GCAAGTGTCATTGACTTTTGTTGCATTGCTGTGAAATGCACATTCGGAGCAGTTGAAGGT
CTCTTGCTGAATGCTCACATATTTTCAAAATATTGTTTTGGCTGCGGAGTTTGTGCCTGA
TCAGTAACTACCAATCTCGTGAGATTTTTCATAAGCATCTTTGAAAGCTTTTATACTTAT
TTGATCTTTGTATATATCAGGTTTTACCAGTTTAGCCGCCAGAGTTTTGGTATTTATGTG
TTACCCGGTATATCCATATGCCTTTTCTTGGTGGCAAAAAAAAGGTACTTCCTGATATAA
AGAAGCTGGTAAGCTCTCGATAACTGATCTCTTTGTCTTTGTGCAGGATTGGATAATACA
ATAATTATAGAAAAGTTTCTATTTCACCACGAACAACATT
Chr coordinates Chr VIII from 40084-45690
w3c xhtml validator w3c css validator