Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SBP1
Systematic Name YHL034C
Alias SSB1, SSBR1
Strain S288c
Description Putative RNA binding protein; involved in translational repression and found in cytoplasmic P bodies; found associated with small nucleolar RNAs snR10 and snR11
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SBP1 YHL034C
AATATCACAATAATTTTGCATGCCTTAGTAGTTTTGGATTACCTAAGCTATGTTGATCGC
ATCCAAGATTATTAGGTCAGAAGGTCATTAACATCCAAAAGCGATATGATTGTGCCATTG
AAGTGAGTGAAAGCCGTGGTTTCGAGACAAAGTTACAGAAGTAGTCACCGTTGTAAATAA
GTATTGCCATATCGGATTGATGCTGGGAAGAAGTTCAAATTCATATTCTCACTTGCGCTA
CCCGTGCAGCTGGCAATCTTGAAGCCAGCGTCCAGTTAGTCTGATATGGCGTGTTTAACG
ATGTTTGAAACTCCACGATCATTGGTCGAGTCAAGAATAAATGTAATGTCATTTGAAATG
TCGTCAGTAGACGTCCGTTACAGTTATGAAAGACTTCGAGGCCGCACACTAAGAGTCACC
ATGCTACTTCTGCAGGTGGCCGCGCTGTACACTTGCATTTTGTATGGGGAACTTTATATT
TAAAATTAAGGCTAAGGCAATGTAGGCACTATCTAGGGATCTCAAATACATAAATTTCTC
TGCAATTAAGTTATTAGATCTACAATTTACCAATTTTATCATCGAGCGGAAAATATTGAA
AAGTATATACAATTTCTCCTAAAAAGGCCCTGCTCGTTTTGACCTGTACTAGTAACTATT
TTGCAGCCAATTATGGTAGTGAAAATATGATAGTACACTATTTTTTGGGTCACTACTGCC
GCTAAATATTTTAAAATTTGTATGAATTGCCTCTTTATTATCTTTAAATTCCCGTCCCAG
GTGACGCGTCGCCAAAGGGAAGGGGCAAAACTAGTCGAAAAGCAGAATAAAATTTTTCTA
ATTTAGCCACCCTGAGTGTCACAGGTTGTGGCATAAAGGATACGCAATTGGACTCAAAAT
AATCATTCTGCAAATTTAAAGGAAGTTACTGAGTTATCACTACATCGAGAGAAGAAGTTT
CCCCCAAAAGAAAGAAGAAAACCCTCAAACGAAGAAAAAT
Chr coordinates Chr VIII from 34077-33193
w3c xhtml validator w3c css validator