Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MUP3
Systematic Name YHL036W
Strain S288c
Description Low affinity methionine permease; similar to Mup1p
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MUP3 YHL036W
GTTAGATCTGTTCTAACAATCTTGAATGCGTGTTCGCGAGGGGCGTTTATATCACGTAAT
AGCAGTTTTTGCAAGTCCGTGAGTGAAATATTATACAGTACTCCTTCAAGATCACAATAT
TCATAAGATAAGTTTGTCTTCTTAAACGCTTGCTTACAGCGAGGGAACACCTGATGTGTG
ATATTCTCCATGTTGAACTTATACCTGTAACGAGAGGAACTGCCCTGTCTCCTCAATGAG
ACCATGAACAATGTTTGCCAATTCACCATTTTGGTCACTCTGTCTCAAACCTTTCCTTCA
GCGCAGCCTTACTCCTTCAAGAGAAGCCTTCATTGTCCATTCACTTAAGCATAATTTGTC
ATCTTCAATGCAATTGAACTTTCACTAAATACACCCATACACACCAATCTTGGATTCTAC
TCGGCGGCAATCTTCACTCTTTCCTTTGTTTTATCATTTTCTATTCCACCTTTAGTTCCC
CAACTTCACCTCTTATCGAACTATCAACACATTTGACTATCATTTTGGCAAATTCACTCA
CGTGAGGGCGTGTGCTAACCATGCAAGGGTTATGGCATGCGCATCCATGTGGCGTTTCCT
ACTTTTATTTTTACATAATATATAAGATAATTGCACATGCAAACAGTCAATCTTTTTCCT
GCAATTGATGTGGAGACCAAAAGGTTTGCATCTCCTAGTACCACGATTTTTTGGTGCAAA
AGTGTTGATAATGTAATTCAGGTAGAAAAGGTAGAAGTTTCCTCTAGTATGTTCACAGAT
TGGATTAGAAAAAAAGATCACGCGACTCTTGCCGGAAAAAACTGTGGCGTCGCTGCATAT
ATATGACAAATCAATCATATAGATTAGAGGCCTGCCTGAGTCAAGGGGCAAAAACAATAC
ACATATAAAGACCTGGATGCTTATCGATGATCTGTACATTCTGTTTGTAGTCTAAGTTGC
TGAGGGCAACGTAGACGTACAGTGCTCAAAATAAGTAAAA
Chr coordinates Chr VIII from 26241-27881
w3c xhtml validator w3c css validator