Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ECM34
Systematic Name YHL043W
Strain S288c
Description Putative protein of unknown function; member of the DUP380 subfamily of conserved, often subtelomerically-encoded proteins
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ECM34 YHL043W
CTATTAGCGGAAGTCATTACACATAAACCTAACATGGACTTGAGCACATGGGACCGGATT
GCATATGACATGAACCAATTTGTATATGACCGTCGTATATGTGCAGATAGATCTTTTTTC
TACGATGGCAGTTATTGCTATCAGGTTTTTAAAAAGTTGGTGGCTACCCCGTACCTTGTG
AATTCCAATATGAATAGTATATATGCTGATCTGGAGATGAGAAGTAATGGAGCAACCAAC
ATTAACGATTCTGGTAATAGTTCATTACACATCGAATTGGGCACTTATATTTTTAAAGCA
TTGGCCGTTTTCAGGAACTCTGTTGACAAGTACTGGGAGGATAAGTATCCAGAGATGGGG
GTCACAGTTTGATTGGAAGGTATTTCTAGGTTCTACTTTAGTTTTTTATAACGCATCCAG
TACAAAGAAATGATATTGGTATTTGGAAAAGTCATTGAATATTCTTGAATAGATTATAAG
TGAGCTTCCTTTCTGTATCAGGATATGTGGCTTAACTTTAAACTCGTATAATAAAAGTAC
TCGTATTTTTGTGGGATGTTTGCCTCCGTAAATTTATAAATGGCAACAGGAACACTATTA
TAATGTAATGTTACAATATTACTTTTACTGTATAAGTTTAATGCTTTATAAAACTAGATG
GCAGCTTCTAAGTTGTGGCTTGTGTCGGAGGTTCAAGCTGTCCTCCAAGTTCAGCGCAGC
GATTATTTGCAAATTATCTACGTAAGGACTATATAAACGTTTCGATGCCCTCTCTTCACA
TCTTTTGTGTCGAACCTCGAACATCGAGCATGCATTGTCCATTTTTGAGCCAGTTTCTGC
TTATTCTCGTATTTCAACAATAATGTTGTTGCATAATGTACGCACACTTTGTGCGGCATT
TTATAGCTTACAGATACAGATGAATTTACGAGCTGTATAAAAGAACTACAAGGAAGTTGT
AACTGCAAAAAAATGTCACCGGGACGATATCATCACAAAT
Chr coordinates Chr VIII from 14901-15413
w3c xhtml validator w3c css validator