Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name COS8
Systematic Name YHL048W
Strain S288c
Description Endosomal protein involved in turnover of plasma membrane proteins; member of the DUP380 subfamily of conserved, often subtelomeric COS genes; required for the multivesicular vesicle body sorting pathway that internalizes plasma membrane proteins for degradation; Cos proteins provide ubiquitin in trans for nonubiquitinated cargo proteins
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>COS8 YHL048W
ACTCAATTTATATACACTTATGCCAATATTACAAAAAAATCACCACTAAAATCACCTAAA
CATAAAAATATTCTATCCTTCAACCATAGTACATAAACACACTCAATTGCGTATCAATAC
CACCATGACGTCATTAACTTAAATGTTCCTTAATACCGTCATACCACTATGCTCTATTCC
ATATATTGTAATATAACTGTACTCTATAGTCATACAGACGCTTTTACTTCACCCTATCTT
CTCATACTATTGTCATAGAATCTCACACTGACGCATGATTAAAACGAATAATTTTTACTA
TAAGGCCTCCCATCCGTGCTCTACCCTTTTGTTTGCAATATTTATACAGAATCTCAAAGC
AAGCGGGAGAAGTGGTGATTACCCAGATGTCATGCATGATCTGAGCACCACCGTACCTCT
AGGTTTTGCCTTGATCAATTTTACAGTGACACCAAGCATAAGGATAAAAAATGGTATTGA
AAGGTTGTCCACATTTGTAAGTAACTTGGTTCTATGAATCTTCATGTCAGATACGTAGGA
CGGACTCTTTCCTGTGTAAATATTTGTGACAGCTACGTCTATTTTCTACTAGATGTTTAC
ACAGTTTTGTCACAGGAAATCTACGCTTAAAATATGTATTTCATTCAAGCGGTAACCGCT
GTACGAGCAGTGACATTGCTGGTCGCACCTTAAATGTAAACCAAAGTTACGGCACACCGT
GATGCACCCGCATTAAAGTTTTGTAAATTCGTTATTACGATTATCGAGTTGGCTAGATAG
AAAACCGGAAATGAAATGGATGCCCTTTTCGAATAGCTGAGTTTCTTTGCCTAAAATAGC
CCAATATTGTTTCCCTTTTTCTATCACGAGGTTACTGAGCCATTGCATGAACGCGCGCGC
CTCGGCGGCTTTTTTTTTCTGCTGTGCTGTATAAAAGCGAAAAGTCAGAAGTTACTATTT
CGAATAAAAAACCCCTCGAACTGCCATCTCACTACCGAAA
Chr coordinates Chr VIII from 6401-7546
w3c xhtml validator w3c css validator