Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name TCD1
Systematic Name YHR003C
Strain S288c
Description Protein of unknown function, localized to the mitochondrial outer membrane
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TCD1 YHR003C
GAGACCTTAATTCACTCGGCTTCTCGAAGTACAACGCATAGTAATTCTTCTCAGGGTCAC
TTGGTGGAAGTGAAGTTTGGATTGAGCGGAATTCGTACACTATACTTTATTCACAAGAGG
CCTTACTGTGATTTATTTTTGACAAAAGTTAGCAAATGGTACGACCTTATCATTTTTACA
GCATCCATGAAAGAATACGCTGATCCTGTGATAGATTGGTTAGAAAGCTCCTTCCCATCC
AGTTTTTCAAAAAGATATTACCGTTCTGATTGCGTTCTAAGGGATGGTGTTGGATACATT
AAAGATTTGAGCATTGTCAAGGACTCCGAAGAAAACGGGAAAGGCAGCTCCTCTTCTTTG
GATGATGTCATTATTATAGATAACAGCCCGGTAAGTTACGCAATGAATGTAGATAACGCT
ATTCAAGTAGAAGGATGGATAAGTGATCCAACTGATACGGACTTACTGAACCTGTTACCT
TTCTTGGAGGCTATGAGGTATTCAACAGATGTCAGGAATATACTGGCATTGAAACATGGA
GAGAAGGCATTCAACATAAACTGACAATTGTTATTGTGTCCTTCCAAAAAAGATGAGAAT
TTTAGGTGATAAATCGCCTATCCATTGCTGCTCATTTAATGGAAAGGTTATTGCATTCAG
GGAAAAAAGTAACGGGAGAAAAAAGAGAAAAGACCTCTTTTTTGTTTTCTACATACGAGC
ATATTAATTATTTAGCAGGAAGATATACTTGATCTAAACAGTATATATATATATATATAT
ATATATAGGTTGGGAATTAATCTTGAAATTTTTTTAGTCTTACGTTATCTTCAGCAGTGA
CACGCTAAATGCCCGTATCTTACTTTACATTTTGCTGTCAGGTTTTTTGATTTCTTTTTC
ATATTTTATGCAGTAGCGAAAAGAGACAAGACTATGAAAAAATTTTCTAGCGTTAGTAAA
GTATTAATACTGCAATTAGTTAGGATAGCAGAACGAACAA
Chr coordinates Chr VIII from 111317-110028
w3c xhtml validator w3c css validator