Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RPL27A
Systematic Name YHR010W
Alias eL27, L27A, L27e, RPL27
Strain S288c
Description Protein component of the large (60S) ribosomal subunit, nearly identical to Rpl27Bp and has similarity to rat L27 ribosomal protein
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPL27A YHR010W
TAATATGATGCGTCGAAGGGCTGAAACTTGGATGCTGGGTCAAGTAGTAAGCAGTACAGC
AACCGATGATACCGCCACCTACAATGACAATATGTTTTTTCCCTTCGCTGTTCTTTGAAG
GGTACGTTTGAAACGGTGGGTGCATAAAATCTTCACCCATTTATAAACACTATTCCTTCT
GTTGCTTGGTTAAAATGCTATTGATACTTAGATGGTGTATTGGAGAGCACGAAAATCTTT
TGCTGAGTGACTTGAACTATCAAACAGAATTACTTGTTGGCTGATTTTTTTTAAGTCTTG
ATTTAACAATAGAAAAAAAAAAAAAAAAAAAAGGAACAATATAACTTTTGTAGTACGTGT
GCCAGGTTACAGATATGGTTTCACTTCTATGTCGTGCTTTTTTCATTCATACGTAATCTT
ATGCATGTAGGGGATAGACGCACAAAAGCACCAAGGCTGCATGTATTGATAAATTGGCTT
ACACGATTCCAGCTAAGGGGACTCGGACGGAACCGTCTCATATTATACGTTCAGTGAATA
TTTTTCACGGAAGAATGGAAAGGGCCTCGAAAGACGTTAATGCATCCGTACACCTACATC
TTTACATTTTTTGCTGTTGCACCTACACTGTTTTTTTTTTTTTCACCTTATGAGTCCTGT
ATTTCTTGAAAGAGCCGATAACAATATTCCAGGTGGAGTCCCGAGGCAGAATCAAGGCTG
CGGAGAGAAGTTCCTCTCAAACTAATGGGAGTGATCCGCTCAGTTCTCCCATCACGACAG
AACTGTCTGAGACAAAGTCTTTCCAGCAGAGCTCCGCCTACGCTCTTGCTGCAGAGATTC
GCCCGAAGGCAGGTTTCCTGAAATTCTTTTCACTAGTAAAGTGTTCGTTCATGTAAAACA
TACTGCCGTAGTTTTGAGCTAAAATTAAAGATATATTAGATTTTTAGAATTTCTTAGATA
GTCTCAACGTGTTAAAACAAAAGCATAACCAAAGAAAAAA
Chr coordinates Chr VIII from 126521-126551,127113-127492
w3c xhtml validator w3c css validator