Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ARG4
Systematic Name YHR018C
Strain S288c
Description Argininosuccinate lyase, catalyzes the final step in the arginine biosynthesis pathway
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>ARG4 YHR018C
ATGTCAGACGGCACTCAAAAACTATGGGGTGGGAGATTCACTGGTGAAACCGATCCTTTG
ATGCACCTTTACAATGCGTCTCTTCCGTATGATTATAAGATGTATAAGGCAGATTTAGAA
GGAACTAAAGTATACACAGCGGGCTTGCAGAAGTTGGGTCTTCTAACGGAGACAGAATTG
GCAAAGATCCATGAAGGTTTGGCTGAAATCAAAAAAGAATGGGACGCTGACAAATTTGTC
CGTCATCCAAACGACGAGGATATCCATACTGCGAATGAAAGACGTCTTGGTGAACTAATT
GGCCGCGATATTGCTGGTAAAGTCCACACCGGTAGATCCCGTAATGATCAAGTTGTTACC
GATTTGAGAATATACTGTCGTGACATTGTCAATGACACCCTCTTTCCAGCTTTAAAGGGC
TTGGTTGAAGTTCTAATTAAGAGGGCCGAAGGTGAGATAGATGTCTTAATGCCAGGCTAC
ACACATTTACAAAGGGCACAACCTATTAGATGGTCTCATTGGTTGAGCTCTTATGCAACA
TACTTCACCGAAGATTACAAGAGACTGGGTCAAATACTACACAGATTGAATCAATCACCA
CTGGGTGCAGGCGCTCTTGCTGGTCATCCTTACGGCATTGATAGAGAATTTTTGGCTGAA
GGTTTGGGTTTCAATAGTGTAATTGGTAACTCCTTGGTTGCTGTTTCTGATAGAGATTTC
ATCGTGGAGTTGATGTTTTGGGGAACTTTGTTCATGAACCATATTTCTCGTTTTGCTGAA
GATTTGATTATATATTGTACAGCAGAATTTGGTTTCATACAGTTGAGCGACGCCTATTCA
ACAGGTTCTTCTTTAATGCCTCAGAAGAAGAATGCAGACTCGTTAGAGTTGTTAAGAGGT
AAATCCGGTAGAGTATTTGGTGATCTGACAGGATTCTTGATGAGTTTGAAGGGTATCCCA
TCTACTTATGATAAAGACATGCAAGAAGACAAAGAGCCACTATTCGATTGCTTAACAACT
GTAGAGCACTCCATGCTGATTGCCACAGGTGTTATTTCTACCTTAACTGTAAATAAGGAA
AAGATGGAAGCTGCTCTCACGATGGATATGCTAGCTACCGACTTGGCAGATTACTTGGTC
AGAAAGGGTGTTCCATTCAGAGAGACTCATCACATATCTGGTGAGTGTGTCGCTACTGCT
GAAAGACTTGGTCTAAGCGGTATTGATAAATTAACCTTGGAGCAGTATCAAAAGATCGAT
TCGAGATTCGGACAAGATCTTTTTGAAACTTTTAACTTTGAACAAAGCGTTGAAAGACGA
GATGCTACTGGTGGAACCGCTAAATCTGCTGTATTGAAGCAATTGGATAATTTGAAATCC
CAATTAAATTAG
Promoter Sequence
Download FASTA
>ARG4 YHR018C
ACTTTAAGGCTCCAAAGGCTCCATTCATGAGATTACAGTACAAGGATGCCATTACCTGGT
TGAACGAACACGACATCAAGAACGAAGAGGGCGAAGACTTTAAATTTGGTGACGATATTG
CAGAAGCTGCTGAAAGAAAGATGACCGATACCATCGGCGTCCCAATCTTTTTGACGAGAT
TCCCAGTAGAAATCAAGTCTTTCTACATGAAGCGTTGTTCTGACGACCCCCGCGTCACTG
AATCCGTCGACGTTTTGATGCCAAACGTTGGTGAAATCACTGGTGGTTCTATGAGAATCG
ACGACATGGACGAACTAATGGCAGGGTTTAAGCGTGAGGGTATTGATACCGACGCCTACT
ACTGGTTCATTGACCAAAGAAAATACGGTACTTGCCCACATGGTGGTTACGGTATCGGTA
CCGAACGTATTTTAGCCTGGTTGTGTGACAGATTCACTGTCAGAGACTGTTCCTTGTATC
CACGTTTCAGCGGTAGATGTAAGCCATGATCTTTAGTTACTGAAGAGTACGTGAGCGCTC
ACATATATACAAATATTTATACCGATTAATATTTACGTTCCTCCCTCTCTCTAATTATTC
ATTGATTTATTCAAGAATTAGCGTTATAACAATAAATGGTTGGCGCAGGCAATTAATTTT
TCTTTACTCTTCCAAACCCTCTGTTAACGACAATCAAATAACCTGATCTGCCAAGGCTCC
ATCATATCTGGCCTAGAACAGTTTTTTTTTTTCGATTATTTGTTCGTTCTTGTGGTGGTT
ACTCATTGGCAGAATCCCGAAAATCATGATTAGTAGATGAATGACTCACTTTTTGGATAA
GCTGGCGCAAATTGAAACATGTGAAAAAAAAAAAAAAGGATTATAAAAGGTCAGCGAAGC
ACAGAACTCTGAGATAAGACTACCTTTCTTTAGCTAGGGGAGAATATTCGCAATTGAAGA
GCTCAAAAGCAGGTAACTATATAACAAGACTAAGGCAAAC
Chr coordinates Chr VIII from 141402-140011
w3c xhtml validator w3c css validator