Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RPS27B
Systematic Name YHR021C
Alias eS27, rp61, S27B, S27e, YS20
Strain S288c
Description Protein component of the small (40S) ribosomal subunit; nearly identical to Rps27Ap and has similarity to rat S27 ribosomal protein
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPS27B YHR021C
CATCCTCCAAGTTCAATGTAAATGTTGAAGATTTGTTCTTGGCAGTATTATTGAAAATTG
AAAAATCTAAAAGTGATCGCAGGAAACTTTTGTAAGGGTTTATAATCAAGATGTATCCGC
TGGAGAATTCGCCTCTCTTACGTGACAAAGAGAAGACCTGTGTTATTGAAACTGGAGGAG
GAGGTAATACAAGCTTCGAAAGCCATTCAGTAACAACTACTCTAGATGAACCAAAAAAAC
CTACAACAAAAAAGGGTGAACAAACGCCAACGAAAACGTGCTTGGCTAAAAACGCTACCA
CTCGAAGGTCAAATGAAAGTCCGTCGAATGATGAAAAGAAAAAAATAAAAAAAGGCATAA
TAGCCTGCTGCTTAATGTGAAAATAAAAAACAAGAAGAACATGTATATATATGTACTTTA
TTAGAAAGTGAAAAGATCTGTTCATTGTGACAGCTATCTACTTATTATCTATTTTATAAA
TCCCATAAATTCTTTCCATATTACTTACGTCTATTATAACCTTCCGCGTAAAAAAGAAAT
ATTGACATCCTTTCTTGTATTTAGCCCATACATTTTCACCCATGCACCATTGGATTATAA
AGAAAAAAATTTAATAAAAATCTGCCGGGGAAATTTCAGAAGAAAAAAGGAAGGTGTGTT
CGCATTTAACACGGGCCACCATAAACTTTTGTTTGCCACCCATCTAGACGGGATCCGCCC
CGCCCAAGGCTCTCTTCCTCTAGCTAGGCAATGTGGCTCTCGGAAAGGAAACTCCCACCA
GGACGTGGTGGGAAATGCAGCAATTCCCCTCTGCTTCCCGCTGACCTTTCTTGGGCCCAG
TTTAGTAAGTATGCTCTCATCTTTCATGTGTGCTGTAACTTGCAAGTCATTAACACTATC
TATAATTGATATTAGACGTTAAAAGTTCTATATAGCATTTGCTTTTATTTAGAGAATACG
AAAACACACCAGATAATTAGTGCATATATATTAGATCAAT
Chr coordinates Chr VIII from 148116-147871,148669-148667
w3c xhtml validator w3c css validator