Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name VMA16
Systematic Name YHR026W
Alias PPA1
Strain S288c
Description Subunit c'' of the vacuolar ATPase, which functions in acidification of the vacuole; one of three proteolipid subunits of the V0 domain
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>VMA16 YHR026W
TGTTGGACTACTGTTTGATGATTGAACGTCATCCAGACAACATAACCGCTGCTATGATGG
GAGGCTTTTGCGGTTCATTCCTAAGGGACTTGACCCCACAAGAGGTGGAAAGACGTGAGA
TTCCATTGGCTGAGGTGCTTCCAGAACCTTCTGGTGGTGAAGATACCGGTCTGGTTCCCC
CATTACCTCCCACCGATATCGGTAGACATGTCAAATACCAATGGAACCCCGCCATTAAAT
GTATTGCGATCATCCCACAGTTCGAGTTGTCCACCGCCGACTCCAGAGGCGTTCTTCCAA
AAGCCTACCCAACCCAGGACTTGGTTTTCAATCTACAAAGATTGGCCGTCTTGACCACAG
CTTTGACCATGGACCCACCTAATGCCGACTTAATCTACCCTGCTATGCAAGATCGTGTCC
ACCAACCTTATAGAAAGACATTGATCCCAGGTCTCACGGAAATCTTATCATGTGTCACCC
CATCCACATACCCTGGCCTATTGGGTATCTGCTTGTCAGGTGCAGGCCCAACTATCTTGG
CTTTGGCCACTGAGAATTTCGAAGAAATCTCTCAAGAAATTATCAACAGGTTCGCCAAAA
ACGGCATCAAGTGCTCCTGGAAACTACTGGAGCCTGCCTACGATGGTGCTAGCGTCGAAC
AGCAATGAAATGTCCTTTACCCCTAGTATACTGTGTTAAATACTATTGTAGACCATATAC
ATACTGTAATTGACCGTTAACGGTTATTATGCTGAGTCTTCTTCCGTTACCCGTCTTTTC
TATCTATTTCGAAAATAAAAAATAAGTGAAAAGAACGAAATTTCACAACCATTAACAATA
CAGATAATGAATCGAAGTTGTTTTCAGTCTCAATTCAAAAGACTCATAGCCAAGGCCAGT
TGATTGATTTAGCCACAAGTATCATTCAACGTAATATCCACAGGTGTTTTTTTTCTCACC
GGAAGGCGAATAAAATACAGGAGCTAGAGCGTGTAAGATA
Chr coordinates Chr VIII from 160844-161485
w3c xhtml validator w3c css validator