Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YHI9
Systematic Name YHR029C
Strain S288c
Description Protein of unknown function; null mutant is defective in unfolded protein response; possibly involved in a membrane regulation metabolic pathway; member of the PhzF superfamily, though most likely not involved in phenazine production
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YHI9 YHR029C
TCTAAAAATGTTCAGGACTACATACATCAATTAGGTTTCATTCCAAAAGTACCTTTTGTC
AATTTATACCCAAATGCCAATTCACAAGCATTAGACTTATTGGAGCAAATGCTCGCGTTT
GACCCTCAAAAGAGAATTACCGTGGATGAGGCCCTGGAGCATCCTTACTTGTCTATATGG
CATGATCCAGCTGACGAACCTGTGTGTAGTGAAAAATTCGAATTTAGTTTTGAATCGGTT
AATGATATGGAGGACTTAAAACAAATGGTTATACAAGAAGTGCAAGATTTCAGGCTGTTT
GTGAGACAACCGCTATTAGAAGAGCAAAGGCAATTACAATTACAGCAGCAGCAACAGCAG
CAGCAACAGCAACAGCAACAGCAACAGCAGCCTTCAGATGTGGATAATGGCAACGCCGCA
GCGAGTGAAGAAAATTATCCAAAACAGATGGCCACGTCTAATTCTGTTGCGCCACAACAA
GAATCATTTGGTATTCACTCCCAAAATTTGCCAAGGCATGATGCAGATTTCCCACCTCGA
CCTCAAGAGAGTATGATGGAGATGAGACCTGCCACTGGAAATACCGCAGATATTCCGCCT
CAGAATGATAACGGCACGCTTCTAGACCTTGAAAAAGAGCTGGAGTTTGGATTAGATAGA
AAATATTTTTAGGACAAAAAACTATAAGTAACCGGGGAAGTATAGAATCACCATAGATGT
AAGCTTACAGACAATGTGTATATATGATGTATATGAACGTATACAAATATATATATATAT
ACGTGCTCTTGTTGTAGCTCGTATATCAAATTCCTCCTCCGACGCTTATCTTAATCGTAC
TCCGCGGAAGTTTGTTATCGCCTCTTGAATTCTTTCTTTTCGTTCATTTATGATTAGTCA
TCTATAGACAATATTCATTATTTAAGCACCTAGAATACTAAACTAAATGTCTAAATATGA
CACAAGGAAGATAAGATAAAAAAAACCAAGCGCTTAGAAT
Chr coordinates Chr VIII from 168561-167677
w3c xhtml validator w3c css validator