Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YHI9
Systematic Name YHR029C
Strain S288c
Description Protein of unknown function; null mutant is defective in unfolded protein response; possibly involved in a membrane regulation metabolic pathway; member of the PhzF superfamily, though most likely not involved in phenazine production
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>YHI9 YHR029C
ATGACTTTAATGGTACCTTTCAAACAAGTTGATGTATTCACTGAGAAGCCCTTTATGGGA
AATCCAGTAGCAGTAATAAACTTCTTGGAAATTGATGAAAATGAAGTCAGTCAAGAAGAA
TTGCAGGCAATTGCCAACTGGACAAACTTATCAGAAACAACGTTTTTATTTAAACCATCT
GATAAAAAGTATGATTACAAGTTGAGGATCTTTACTCCAAGAAGTGAATTGCCATTTGCT
GGTCACCCAACCATTGGTTCATGTAAGGCTTTCCTTGAGTTCACCAAAAACACCACTGCG
ACTTCTCTCGTCCAGGAATGTAAAATAGGCGCTGTTCCAATAACAATTAATGAGGGACTA
ATTAGCTTCAAAGCTCCGATGGCTGATTACGAAAGTATATCGAGTGAGATGATTGCTGAT
TATGAAAAAGCGATTGGTTTGAAATTCATAAAGCCTCCTGCTCTTTTACATACTGGGCCA
GAGTGGATCGTGGCGCTAGTAGAAGATGCAGAAACTTGCTTCAATGCAAACCCAAATTTT
GCTATGCTTGCACACCAGACAAAACAGAATGACCATGTGGGAATTATCCTAGCGGGCCCT
AAAAAGGAAGCCGCCATCAAAAACTCCTACGAAATGAGGGCGTTTGCTCCGGTGATAAAC
GTTTATGAAGATCCTGTTTGTGGTAGTGGTTCTGTAGCCCTTGCAAGATATTTGCAAGAA
GTTTATAAGTTTGAGAAAACCACGGATATTACCATTTCTGAGGGTGGAAGGTTAAAAAGA
AATGGCCTAATGTTAGCTTCAATTAAGAAAGAAGCTGATAATAGCACTTCCTACTATATA
GCAGGTCATGCCACTACCGTTATTGATGGTAAGATCAAAGTTTAG
Promoter Sequence
Download FASTA
>YHI9 YHR029C
TCTAAAAATGTTCAGGACTACATACATCAATTAGGTTTCATTCCAAAAGTACCTTTTGTC
AATTTATACCCAAATGCCAATTCACAAGCATTAGACTTATTGGAGCAAATGCTCGCGTTT
GACCCTCAAAAGAGAATTACCGTGGATGAGGCCCTGGAGCATCCTTACTTGTCTATATGG
CATGATCCAGCTGACGAACCTGTGTGTAGTGAAAAATTCGAATTTAGTTTTGAATCGGTT
AATGATATGGAGGACTTAAAACAAATGGTTATACAAGAAGTGCAAGATTTCAGGCTGTTT
GTGAGACAACCGCTATTAGAAGAGCAAAGGCAATTACAATTACAGCAGCAGCAACAGCAG
CAGCAACAGCAACAGCAACAGCAACAGCAGCCTTCAGATGTGGATAATGGCAACGCCGCA
GCGAGTGAAGAAAATTATCCAAAACAGATGGCCACGTCTAATTCTGTTGCGCCACAACAA
GAATCATTTGGTATTCACTCCCAAAATTTGCCAAGGCATGATGCAGATTTCCCACCTCGA
CCTCAAGAGAGTATGATGGAGATGAGACCTGCCACTGGAAATACCGCAGATATTCCGCCT
CAGAATGATAACGGCACGCTTCTAGACCTTGAAAAAGAGCTGGAGTTTGGATTAGATAGA
AAATATTTTTAGGACAAAAAACTATAAGTAACCGGGGAAGTATAGAATCACCATAGATGT
AAGCTTACAGACAATGTGTATATATGATGTATATGAACGTATACAAATATATATATATAT
ACGTGCTCTTGTTGTAGCTCGTATATCAAATTCCTCCTCCGACGCTTATCTTAATCGTAC
TCCGCGGAAGTTTGTTATCGCCTCTTGAATTCTTTCTTTTCGTTCATTTATGATTAGTCA
TCTATAGACAATATTCATTATTTAAGCACCTAGAATACTAAACTAAATGTCTAAATATGA
CACAAGGAAGATAAGATAAAAAAAACCAAGCGCTTAGAAT
Chr coordinates Chr VIII from 168561-167677
w3c xhtml validator w3c css validator