Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PIH1
Systematic Name YHR034C
Alias NOP17
Strain S288c
Description Protein of unresolved function; may function in protein folding and/or rRNA processing, interacts with a chaperone (Hsp82p), two chromatin remodeling factors (Rvb1p, Rvb2p) and two rRNA processing factors (Rrp43p, Nop58p)
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PIH1 YHR034C
TTTTGGATTCAAAATGGTGGTTTTGTCTCATGCTTTCACCACGTTCTCTTGACATAACTT
TGCCGCCACCCTTAGTACATGGACCATTCAGGAATGAAACTATATGACAGTAGGCTGACA
AACTGCACTGAGACGCCAGTACGGATGAAACGAACAGCGCTAATCCGGTGCAACGCTTGT
CCCTTTTAGAACTGATATTCACTTTGTTTGCAATCTTGCATATTTCCCGTAGCAATTTTC
TTAAAGAACCCTGAGTAGATTTATCAAACCAGTATGATTCTTGATTGATTTCTGAAATTT
TTTTCTCGAAGTAACTGGCATTTAATTTATCAAGATTATATTTGGTCATAAATTCATTTA
TTGAAAATACAGCATCACGTCTGTGATTCACAGCATTGTGTAAAATCACATGACCTGATT
GCTGAATAGTAATTATTGATAGTGGCTCTTGTTGTCTTGTGATGTAATTATTACATAGAA
TGGAAACTAAATAATTTAGCTCATGAGGATCGCAAATAGCGTCTATAATCATAATGGTCC
GTCTTGAAAGTATTTCTTTCTTTGCAGAAGTCAATGTATAGGTGTTGGAAGGTACCAGTG
GCAATTCAGCATTTGAGTTTGATTGGTTGCAGAATAGACAAGTCCAAACATTCTGTTCTC
GTAGGGAACAAGCCATCGAATAATAGGCGCCACATTTGGTGCATTTTAGATTTTGGTCAT
AGTTCTGCGTCACAGCATCGCTGGAAAAGGGCTCATATAAGAAATTAGTTGGAGAACACA
TAGGCACTTCCTTGGCCAAATTTGGTGCTAGATTGCAGTATTGTACAAATACAGGATTCA
GTACCTGATCACTATTTTTACTCTTGATATTTTTTTTCCTTAAAAAAAATCAGAAGACAA
TAATGATAGAAAAAAACTAGGAATTCTTGAATTCATATGCATGGAAGAAAAAGGAATACA
GGGAACAGACTTTTCAAAGCGAACAAACAGACCTTAACCG
Chr coordinates Chr VIII from 177999-176965
w3c xhtml validator w3c css validator