Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name BRL1
Systematic Name YHR036W
Strain S288c
Description Essential nuclear envelope integral membrane protein identified as a suppressor of a conditional mutation in the major karyopherin, CRM1; homologous to and interacts with Brr6p, a nuclear envelope protein involved in nuclear export
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>BRL1 YHR036W
CACTAGGTCACAATTCAGCTGAAGCTCCTATACAGTTTCAAACCACTTTTGAAAATCAAA
CGGAAAAATACATAAGAATTGAAACCCTCTTATTGCCAAAAGCCAATAGATCATTTGGGG
CACAAAATGAAATTGTGTTTTCAATGAAAAAGATAGCCTCACGAATTATCGATAGCTTTG
CTTACTCATCCAAGCACACTAAAGAATTGATGAAGCAATTGTTTCTATTACCAAATCAAA
TCCGGGGAAAAGACGTAGATATGGTCAATCTGATACAGTGGTGTTATCATATATATAGGT
CTCCAATTCTATCGGTTCGGAATACTTCACCTGATGAAAGGTACCTTTTTCTTCACCGAA
TAATAAACGCTTCTAAAGACACATGCCTTTCATTATGCAAACCCTTCATCTGGAGTTACA
GTGATTTGAAACACGACTGGATCGTGTTGGATGTCCCATTAACAAGAGCCCAGATACTTC
AAGATGATAAAACCACCATTTGTGTAGATGGTGGCTCGTACTTAGTTTTAAGAAGGGGAA
AACTTTTGGAAAAAGAAGGTCGCGAGCTCTGTTGCAAGCTTTTAAATGACTTGCAAAGGT
TTCCGCAGCCATTATATGTTGAAACTAAAACCGGTGGCAGTCAGGACCGTTTCTTGAAAA
GCAAAATTATTCCCTTGGACATCACTGACAAGGAAACTCTTGGTACAGAGGATATGACAT
TCAATGAATATTTCAACTTGTTCACCGATCTAAGTGGAAGCAAATAACTCGCTAAATATT
CTTGCTGCACTTTGCGACGCCTGTATTGGCGAAAACAAAAAGTAAAGAAAAAAAAACTTT
AGATGAAATAGAGCAAAATTCCCTAAGACAATAGAAGATACAAAAGCAAGTTGGGCCCTT
AATTTCATCAAAGGTATAGCATCTCATCAAATAGTCGCTTGTTTATCGCAATACTTGCTT
ATTGAGTAGTTGTATTATAACGTTATATAGGATCTTCCAT
Chr coordinates Chr VIII from 180345-181760
w3c xhtml validator w3c css validator