Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YHK8
Systematic Name YHR048W
Strain S288c
Description Presumed antiporter of the DHA1 family of multidrug resistance transporters; contains 12 predicted transmembrane spans; expression of gene is up-regulated in cells exhibiting reduced susceptibility to azoles
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YHK8 YHR048W
ACAGCGGTACCAAGTGACACATTGCGTACTGTGTAGTATGCGCCGTATATAACTTTTTTT
TTCTGAAGGTACTTTGAATTACAATCTATTTTTTACAGTTCCTATGGCAGGGGTTGAAGA
TATTTGGGTCTGAACCATAGCAGGATTAGTGTTATAGTAGGTATGTGAATAGAAGCTAAC
AAAATGAGATGAACCTCATACAAAGTCGTAGAGAAAACTGCTAACAGAAGAGCTGCGCCT
TGAAATCGTATCTCTAAGCTTATAATAAATTGAAAGGAAAAAATACGTGGTAAATGCAAG
CGACCAAAAGGCTACGGCCCAACGCTAACCCGCCGATAGGTGCATAATCTAATTTACCTC
CACCAGCAGGAGCCCTTTTTCTAAGTAATAAGCAAACCAGATAACTTACATCTTGCTGTA
GGAAACAAAAGCCGGAATAATGGTTCACTCATATTCTTCGTGTGAAACACAGAAGAAATC
CAATATTTGCTTCAGTATTTATCTCTAAAAATTGGTCCTACATTGGAAACCATAAACCAA
TTATAACCGGTGTACGAATTGTAAGCTAGTTCTGGAAATGTCATGTTGCGCAGGTAAAAG
TGGAGCTGAATTGTATATCTGTTTTGATCATTATTATCCCTCTGGGTGAGTGGAAATATC
AATAAAATGCAATGGCACATTTAATATCCTTCTCTTAATTCCGTGATTTATAACATCTTG
ATGCCAGAAACACCTTTCGGATCCGGCAATAAAGCGGAGATTAGCACGCTTTTCGCCGGT
CCTACGGATTTAGTGTTGGCTATTGTTGAGATTAGTAATACGCAGAGAATTTTTCTACCG
GTGAAGCGACCATCTCAGATTATTAGGTCAAGCAATAACACTTGTTATTAGATGCGTTAC
GTTCACCTGGACCCTATATAAAGGCATATTTGCCTTACATTTGGTGTATGGTATCACCTT
GTATACTAAGAACATATATATGCAGATATAACAACAGGAT
Chr coordinates Chr VIII from 204607-206151
w3c xhtml validator w3c css validator