Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CIC1
Systematic Name YHR052W
Alias NSA3
Strain S288c
Description Essential protein that interacts with proteasome components and has a potential role in proteasome substrate specificity; also copurifies with 66S pre-ribosomal particles
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CIC1 YHR052W
CTTTGAGGAATTCACCGCAAGATACGAAAAGGAGTTTGATGAAGCCTATGATTTGTTTGA
AGTGCAAAGAGTGCTCAACAACTGTTTTTCCTATGATTTAGTTCCTGCTCCTGCTGTTAT
TGAAAAAGCTTTGAGGGCTGCCAGAAGAGTCAATGACTTACCTACCGCAATTAGAGTATT
TGAGGCTTTGAAATACAAGGTGGAGAATGAAGACCAATACAAGGCCTACTTGGATGAATT
GAAGGATGTCAGACAAGAATTGGGCGTTCCCTTAAAGGAAGAGCTATTTCCAAGCTCTTC
TTAATAATAAGGAAAAAGCTACCACACAACGTCTGTAATTTGTTGTCCTTTTTTTATTTG
TGGAAAATTCCTCAATTTGAAATAAGATTCGTATTTATTTTGTAAAACGATTTTAGTTTT
TATTTTTTTTTTTTCTTCCCTTTTACCTTATTATTTGTTTTACCCTTTATGGATATTCAT
CCACTCAGAAACTAATATATCAAAATCAACGATAAGATCACAAGAGGTGAAATAAGAAAA
GTAAAAGAAAAATATTTAAATTTAACCATTATGATTTCCACTTTGTTTTCTCTACTCTAT
TACTTGAACAAACTTTATTTTTGGTAATGAGGGCTGGTCACAGATTACCTTTAATATCCT
TTGTTAGTAGCTTTTTTGTGTTCTATTTCAGGAAAGAAGAATGGGAAAAATAATAAAACA
ATAAATAACTATATAAAAAACAAAAACCTAGAATATACCATTAAAGAATTACTATTCTAT
TCTGTGCTTCACCGTTGCGTCAATAAATGTGAAGTTGATGTCACTTCATACTAAAAAAAT
TAAAGACAATTTCCTGAAAAAAATTTTTCCACTGGAGCTCATCGCAAATTTTGAAAAGTA
ACAAAAAGCGTTTGTATACTGCATAAAGAATAGTGTCTGTTTTATAAGAAATATTAGACA
GCAGGCAGATAAACCTACGTTCCAGACTATAAAGTATAAA
Chr coordinates Chr VIII from 210848-211978
w3c xhtml validator w3c css validator