Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CUP1-1
Systematic Name YHR053C
Alias CUP1
Strain S288c
Description Metallothionein, binds copper and mediates resistance to high concentrations of copper and cadmium; locus is variably amplified in different strains, with two copies, CUP1-1 and CUP1-2, in the genomic sequence reference strain S288C
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CUP1-1 YHR053C
TTATTGAAATCTTACAGAATTTTATAGCAATCACATTTGCTATTTTCCAACGTTGTGAAG
TAATATTATATGACGAATTTTACAAAAATCTTTCAAATGAGGAGATTAATGTTCAATTGC
TATTGATTCATGACAAGATTTTGGAAATTTTAAAAAAAATAGAAATTATCGTATCCTTTT
TACGAGATGAAATGAATAGCAACGGAAGTTTCAAATCTATTAAAGGTTTCAACAAGGTTT
TGAATCTGATTAAATATATGCTGAGATTTAGCAAGAAAAAACAAAATTTTGCGAGAAACT
CTGATAACAATAATGTTACAGATTATAGTCAGTCGGCGAAGAACAAAAATGTTCTCTTGA
AATTCCCCGTTAGTGAACTGAACAGAATCTATTTAAAATTTAAGGAGATTTCAGATTTTT
TAATGGAAAGAGAAGTTGTCCAAAGGAGTATAATTATTGACAAGGATTTGGAATCTGATA
ATCTGGGTATTACTACGGCAAACTTCAACGATTTCTATGATGCATTTTATAATTAGTAAG
CCGATCCCATTACCGACATTTGGGCGCTATACGTGCATATGTTCATGTATGTATCTGTAT
TTAAAACACTTTTGTATTATTTTTCCTCATATATGTGTATAGGTTTATACGGATGATTTA
ATTATTACTTCACCACCCTTTATTTCAGGCTGATATCTTAGCCTTGTTACTAGTTAGAAA
AAGACATTTTTGCTGTCAGTCACTGTCAAGAGATTCTTTTGCTGGCATTTCTTCTAGAAG
CAAAAAGAGCGATGCGTCTTTTCCGCTGAACCGTTCCAGCAAAAAAGACTACCAACGCAA
TATGGATTGTCAGAATCATATAAAAGAGAAGCAAATAACTCCTTGTCTTGTATCAATTGC
ATTATAATATCTTCTTGTTAGTGCAATATCATATAGAAGTCATCGAAATAGATATTAAGA
AAAACAAACTGTACAATCAATCAATCAATCATCACATAAA
Chr coordinates Chr VIII from 212720-212535
w3c xhtml validator w3c css validator