Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YHR054C
Systematic Name YHR054C
Strain S288c
Description Putative protein of unknown function; partial duplicate of RSC30/YHR056C, truncated remnant of segmental duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YHR054C YHR054C
GGAATCTGATAATCTGGGTATTACTACGGCAAACTTCAACGATTTCTATGATGCATTTTA
TAATTAGTAAGCCGATCCCATTACCGACATTTGGGCGCTATACGTGCATATGTTCATGTA
TGTATCTGTATTTAAAACACTTTTGTATTATTTTTCCTCATATATGTGTATAGGTTTATA
CGGATGATTTAATTATTACTTCACCACCCTTTATTTCAGGCTGATATCTTAGCCTTGTTA
CTAGTTAGAAAAAGACATTTTTGCTGTCAGTCACTGTCAAGAGATTCTTTTGCTGGCATT
TCTTCTAGAAGCAAAAAGAGCGATGCGTCTTTTCCGCTGAACCGTTCCAGCAAAAAAGAC
TACCAACGCAATATGGATTGTCAGAATCATATAAAAGAGAAGCAAATAACTCCTTGTCTT
GTATCAATTGCATTATAATATCTTCTTGTTAGTGCAATATCATATAGAAGTCATCGAAAT
AGATATTAAGAAAAACAAACTGTACAATCAATCAATCAATCATCACATAAAATGTTCAGC
GAATTAATTAACTTCCAAAATGAAGGTCATGAGTGCCAATGCCAATGTGGTAGCTGCAAA
AATAATGAACAATGCCAAAAATCATGTAGCTGCCCAACGGGGTGTAACAGCGACGACAAA
TGCCCCTGCGGTAACAAGTCTGAAGAAACCAAGAAGTCATGCTGCTCTGGGAAATGAAAC
GAATAGTCTTTAATATATTCATCTAACTATTTGCTGTTTTTAATTTTTAAAAGGAGAAGG
AAGTTTAATCGACGATTCTACTCAGTTTGAGTACACTTATGTATTTTGTTTAGATACTTT
GTTAATTTATAGGTATACGTTAATAATTAAGAAAAGGAAATAAAGTATCTCCATATGTCG
CCCCAAGAATAAAATATTATTACCAAATTCTAGTTTGCCTAACTTACAACTCTGTATAGA
ATCCCCAGATTTCGAATAAAAAAAAAAAAAAAAGCTATTC
Chr coordinates Chr VIII from 214249-213185
w3c xhtml validator w3c css validator