Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RPP1
Systematic Name YHR062C
Strain S288c
Description Subunit of both RNase MRP and nuclear RNase P; RNase MRP cleaves pre-rRNA, while nuclear RNase P cleaves tRNA precursors to generate mature 5' ends and facilitates turnover of nuclear RNAs; relocalizes to the cytosol in response to hypoxia
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPP1 YHR062C
AGACCACATTTATTTCAGGGTGTCATTTCTCATGGCGTTTATCAGGATAAAGCAGGAGTT
TTCAATCATGCTGGGTGGGCTGGTATGAAAATTGCCAAATTGCCTTGGACTGAGGAAGAA
ATGATTCAAAAAAAATCCGTAGTCGAGGACGATGCAGCCAATAACTCATTAGTAAAATTA
TTAACAGAACCAAAATTTGCCAAGGAATTTGGAATAGAACATTCCACTTATCAAGAAATG
CTCTTTGGTCAATTATTTAAATTTTTGGTTAATGCATGCATGAATCCAGTTACGGCTATT
CTAGATTGTGTCAATGGTGAGATGAAGGCCAGTTGCGGTCCAGTTTTCACATCTATTATT
GACGAGTGTTTACAAATATTGAGAGTTGCTTATAGGCCATTGTTTCAATACCACGAAAAA
TACAGCGGTAATGAAGAATACCCAGAAATGGATGTCAATGCAGTACTGACAACCGATAAC
ATGGTCTCCGAAGTCACTAGAATTGGCTGTGACATCAATTCTAGGAACAGTAGTTCAATG
AGACAAGACACTTTGTTCTTAAGAGACATTGAAATTGAGTATATCAATGGCTATGTCGTC
AAATTGGCTGATAACTTAAATCTAGACCCAAACTGCTGCAAGGTTAATAAAACTATCGGA
GAATTGGCCACTATGAGATTAGCATTGAACAGGTCGAGAAGTATCAATGGTGACTGGAGA
AAGGACTGAAAATGCGCGGATATCAGCCAGAACATATACATTTATAAATACTGATATATA
TACACTCTTAATGCTTTATTCGAGCGAACCTTAACAGTCTGAAGGCAGATTAATTTGTCA
AGTGCCTCTCTTTTGTTACTACTACCAGAAAACATGAAAAATGTATGTGCGATGCCCAGA
ATTTTACCTCGCATAAATGAAAAAATTTCATTTTACCAGTAGAAAATACTTAACCTAAAC
AGACACAAAAAACAAAAGTGAAAGCATTATAGAACCGAGA
Chr coordinates Chr VIII from 223758-222877
w3c xhtml validator w3c css validator