Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RRP4
Systematic Name YHR069C
Strain S288c
Description Exosome non-catalytic core component; involved in 3'-5' RNA processing and degradation in both the nucleus and the cytoplasm; predicted to contain RNA binding domains; has similarity to human hRrp4p (EXOSC2)
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RRP4 YHR069C
AGTACACCTTGCTAAAGTCGAATTTGAAAGTGCAGTTGGATTCCTTCTGCTCTACCACTA
GACTATCGCTTTTCCCAGCAATGACTTTCATAGGAAAAGTCCTGAACTGTGTGGCAATGG
AGCTGACTTTGTCCACGACACATTCGATTTTGTTGTTCTTGTCAAGGATGACTTGTCCGA
TGAGCGAGTCGAATGGTTTGAACTCGGTGCGCAAGTTCAAGTGGGCAATGTGGCCTGTGA
TTGTAAAACCCGTTGGAACCTCTTCCAGGAATTGCTCGGGCAGCACGGCTCGAAGAATCT
CCTCAGCTTTCCAGAAATCATAATCGAGCACGTATTCGTGTGGTACAATTTCCGCACTGT
TTTCCTTAAGAAACGCCAAGGCGTCCTCAGGCAATTTTCCATACGCATCCTCCACGCTGT
GGATGGATTCGTGTAGCAGCACACCTTTCGTGACTGGGGTATTATTGCCATCTGCAGTCT
TTAGTTTCTTGTTCTGTACACTTGTCAGTTCGTCCTTTGGCTTGGATGAGTTTAACTTAA
CAACGTGCGGGATACGGGGCACCCTCAAGATGCAATTTTTGAAGTTTTTAGAAAACACAC
TGATATTTTTGGGTTCGGGGAACTTGACTGCACACATTGGTATCTTGGTGATGAAAAATG
ACCTATCCAATTCTCGCATTTGGCGATTCACGGGTGGGTTGTATGGGAACACTCCTGACA
TCTTGCACGAACTGATCAATCTATTAAATTTTTGGAATACTGGCAGTGCGATTTTCATGC
AATGAAAAATATCCTTACCTTTACTTATGGTTTAAACTGGTTTGTTCAAATATCCTCAGT
GAATCTTTTTTTTTCTTTTTCTTCCTCAGTATGGATTGAGCGATGAGGTGAAAAAAAAAA
AAAAATTAAGAAAACTAAAACAAAAGTAGAAGAAAAATATCCTTCCTTAAGTACTGCTTG
CATTCTAAATCTTTGCGTAGTCACACAAGCGTAAACAGAT
Chr coordinates Chr VIII from 234658-233579
w3c xhtml validator w3c css validator