Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name NOP10
Systematic Name YHR072W-A
Strain S288c
Description Constituent of small nucleolar ribonucleoprotein particles containing H/ACA-type snoRNAs, which are required for pseudouridylation and processing of pre-18S rRNA
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>NOP10 YHR072W-A
AATCCTGCTGAAGTTTTTGGTAACATAATGGTAGAATACCCATACGTGGAATGTACTGAT
TCATCCGTTCTGGGGTTGACATATTTTCACAAGTACTTCGACTATAGGAAAGAGGAAATA
CGTACACGCATCAGAATCGCCATCGAATTCATAAAAAAATCTCAATTACCAGATGGAAGT
TGGTATGGAAGCTGGGGTATTTGTTTTACATATGCCGGTATGTTTGCATTGGAGGCATTA
CACACCGTGGGGGAGACCTATGAGAATTCCTCAACGGTAAGAAAAGGTTGCGACTTCTTG
GTCAGTAAACAGATGAAGGATGGCGGTTGGGGGGAATCAATGAAGTCCAGTGAATTACAT
AGTTATGTGGATAGTGAAAAATCGCTAGTCGTTCAAACCGCATGGGCGCTAATTGCACTT
CTTTTCGCTGAATATCCTAATAAAGAAGTCATCGACCGCGGTATTGACCTTTTAAAAAAT
AGACAAGAAGAATCCGGGGAATGGAAATTTGAAAGTGTAGAAGGTGTTTTCAACCACTCT
TGTGCAATTGAATACCCAAGTTATCGATTCTTATTCCCTATTAAGGCATTAGGTATGTAC
AGCAGGGCATATGAAACACATACGCTTTAAGTTTTATTTATAAGTGTTGTTAGAGGCTGC
AACAATTAGAAACTAGTGCAAAACTAGTATATTTATTTGTATATGTAGTAGTAAAATAAT
AGGTGAAAAATTAACATGTGTTTGAAATTCCAGCTAACTATTGGTTATGGTGATTACACG
CTAAGTGTAGAGTTCTTTCAAATATACCATTTATCCTTTAGCACGGCTTCACTATTTTTT
TCGTCTTTTTTCAACTAAGCGGAAGGAGAAAAAAATTTCAAGTTATGCTCATCACTCTTT
TATTACATTATGGTAGCTATAAAGTGGCTTATGTTAGTGAGTTGACGGAAAAGAGAAATA
CTTTCAATAGACCAATACATAACAAATCCTTTTGAACAAG
Chr coordinates Chr VIII from 241664-241840
w3c xhtml validator w3c css validator