Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PTC7
Systematic Name YHR076W
Strain S288c
Description Type 2C protein phosphatase (PP2C); alternatively spliced to create two mRNA isoforms; protein from spliced form localizes to the mitochondria while the one from the unspliced form is localized to the nuclear envelope
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PTC7 YHR076W
AAATTCACAAACAAACCGTTGTCATCCTGAGTTGGCGTCGGCCATTGAGCTTCCTCTATG
TGTTTTAAATCTTTCATTTTAAGAAATCTAAGTAAGGAAATTGTTTCTCCACATGTGTAC
CGTATAAAGTTCTTGTTATGAATTAGAAGGATTATCACAAAAGCCCTCCATCAAATCTGA
TAATTTCATTACCCAAAGACTGTAATACCTTGGGTGTAAAGATCGTATTTTTTGATGTCT
TCGTGATATTTTGCAGATCTTTCCATTTTATAAATTTCTGCAAATATCGTGCATCAGCTC
ATCTTGGAATTGGCACAATCTGCGTAATTTTTTTCTTGGTTCTCTTCTCCTTTTGATTTT
AAGAGCGCTTTCTATTCAGTAGCAGATTTTCAGTAAATAAAGCCATCTTTCTCAAGTAAA
CTCATGATCATGCAGTTGTTCAAAATTACACCAATAACGATGTTATCTTTAAAACTTTCC
CCAGAAAGAAGATGGCACTTTTGCACTAAATACTTCAAACTATTTAACTTTGAAGCAGGA
CATATTGCCGGTTATTTGACCATGCTGGCGCCGTTGACATTCATGTAAGCAGTATTAGCT
TTTAAACTGCCATTAACGCACCTATACGATTGCGGCGGTGCGAAAACAGTAACTAGCACT
CTTACGGCTCATTGTTTCCTCTATCCAAAGTTGCCTATATCACAATAAAATTAGAAATTA
ATCATTTTAATAAGCTTGCTGCCATTCAGTGACTCGCAATCTACGTTTTAAACGTAATTT
AAAAATCCACTTCCACCTACATATTTTGCAACAGTCGTACGACAGAAACTGAGGCTCTAT
AAAATGAGATGTGCTAATTGTTCTTTCTTGGCTGGTTTCAGCTACATCTTTCTGTAATCA
ATCTACAAATTTACACGCGAGCTTCATTTTGACAGTAAACAAATGTAAAAGACACATGCA
ATAAAAGCGGTCCAGAAAACAAACGACAAAGCCACCAAAA
Chr coordinates Chr VIII from 251101-251155,251249-252225
w3c xhtml validator w3c css validator