Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name IPI1
Systematic Name YHR085W
Strain S288c
Description Component of the Rix1 complex and possibly pre-replicative complexes; required for processing of ITS2 sequences from 35S pre-rRNA; component of the pre-60S ribosomal particle with the dynein-related AAA-type ATPase Mdn1p; required for pre-replicative complex (pre-RC) formation and maintenance during DNA replication licensing; relocalizes to the cytosol in response to hypoxia; essential gene
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
Hide Seq
>IPI1 YHR085W
ATGACAAAATCAAGAAAGCAGAAGCAAAAAAAGCAGGATTTTTTGAGAAAAAAGTTAAAA
GTTGGTAAGCCAAAGGAAAAAGCAAGGAATGCTACCGATACATCTTTCGTTTCCAAGACT
ATTTCTATTAGAAATCAACATTTAGACCAAAATCCACATGATTTAACAAAACGGCTAACG
CTCTTAAAGCATCATAACATCAATGTGAGAAAGGAAACATTAACAACATTCCAAAAGTCA
ATACCGTCTATAATAAAATCTCGACTTATGACACCATTACTTACTCAAAGTATACCGTTG
ATTTGCGATGAATCGCAGCAAGTACGTCAGGGACTTATTGATCTCGTAGATGAAATAGGT
AGTCACGATGCGGAGATTTTAAAATTGCACTGCAACATTTTTGTCTTATACATTAACATG
GCAATGACACATATTGTTACACAAATTCAAGCAGATTCTACTAAATTTCTCTCTCATCTG
TTGAAGTATTGCGGAGATGAAGTGGTTAGGAAATCTTGGGTAAAACTTTTGAACGGTGTC
TTTGGAGTGCTCGGTTGGGGACAGGTAGGGAAAAATGATAGCGCTAGCATAGTGCAAACG
AAGAAGCGAAACGCCAAATATGTCACTATTCATCTCAATGCTCTGTACACTCTTGTTGAA
TACGGATGTCAGGATGAACGCGCTAGAAGCGACGGAGACACGGCAGAGACTACAGAGGAC
AGCGGTACGCTACGAAACCCATATTTAATCCCAGATTATCCGCAGCCGTTTGAGCACTTG
AAACTATTTACCAGAGAATTGAAAGTTCAGGATGCTACCTCCAGTGGAGTAAATGCCACA
CTACTGTCATTGGCAACACAGGATATCGATACTCGAAAAGCGGTATTTATCGAACAATTC
CTGCCTATAGTACGTAAGAAAATCGAAGTAATTATCAAGGAAGGTGGTGAATGTGGTAAA
AGTGCAAACAAGCTTAAAACGCTGCTTGCAAAAATCTTTGATTGA
Promoter Sequence
Download FASTA
>IPI1 YHR085W
ACACCAGGTTCCGCGATGTTCCCATACATGCAAAGTTCAAATTCCATGCAGTGGAACACT
GCTGTTTCACCTTATAGTTCGAGAGCACCATCTACAACTGCTAAAAACTATCCTCCTAGC
ACATTTTATTCTCAAAATATAAATCAATACCCACGGCGAAGAACTGTGGGAATGAAGTCT
TCACAAGGAAATGTTCCAACAGGTAATAAACAATCTGTGGGCAAGTCTGCAAAAATTTCA
AAGCCTCTACATATTAAGACAAGTGCTTATCAGAAGCAATACAAAATCAACTTGGAAACG
AAAGCCAGGCCAAGTGCTGGTGACGAAGATTCTGCTCATCCTGATAAGAACAAAGAAATT
TCGATGCCTACTCCGGATTCCAATACTTTGGTGGTCCAGTCAGAAGAAGGTGGAGCTCAT
TCACTTGAGGTAGATACCAATCGAAGGTCCGATAAAAACCTTCCAGATGCAACCTGATAT
AATATAATTTTTGAATTTATGATACAAGAATTAAAAATGCGGGCCAGAATTTAATATTAA
ACAATACTCAGAAGAAAACAACAAGGACAATCTGTTTTTATAAATAAAACAATCTTATAC
AAGACTAGAGCAAACAAAAAGCAAGAAAAAAAGGTAATAAATGTAACAAATCTATTAACG
TTAGAAAATAACAAAAAAAAAAAAAGAAAAAGATAATATAATATAATACCTTTATATATG
TGATTTATCTAGCGTCACAGTATGTAATATAAATATCAATGAGTTTCTTAACATGACCTC
CAAAACTACATGATCGCTTAGTATTACAATATGTGTTTATCCACTATTTTGATACCAACG
TAGTATTGCCTTTTATTTTTCAGAATGGCAAAGGCCATCGGAAAATTTTTCCACCAGAAA
AAGCGAGATTCCTAATTATAAGGTGAAGGCATCGATGTTCATAATAGTTAAAAGTTGTAA
TCAAAAAAGAAAAAGGTGCAGAGATAAACAAAGTTAATAA
Chr coordinates Chr VIII from 276764-277768
w3c xhtml validator w3c css validator