Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RTC3
Systematic Name YHR087W
Alias HGI1
Strain S288c
Description Protein of unknown function involved in RNA metabolism; has structural similarity to SBDS, the human protein mutated in Shwachman-Diamond Syndrome (the yeast SBDS ortholog is SDO1); null mutation suppresses cdc13-1 temperature sensitivity; protein abundance increases in response to DNA replication stress
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RTC3 YHR087W
GCTGACGGTGATATAACAGCGCTTTATTTTCTTTTTTTCATTGCTTTTTATCGTTTTCAA
GATTCCATGTCCTTTTATTAAGTCTTTTTTGTATCGTTATAGTTGCGTTTTTCCTTTTGA
TTTTCATTTCTTTCAAGGTTATTGTTATTCTTAATTCAATTCAAGATTGTACGCTTTTAA
GCATGTTTATGATTTTCCTTTATTACTTCCATTTACCTTCTTTCCATCACTACTCATTAC
GGCCTGTCAATTCCTTTTTTGCGTCACCTTCATTTTTTCTTCTCTGTTCTTTTCTGTATT
TGTCGAAAATTTTATATTGATGTATCTTAATTTTATTTTTAGTATTATTATACTGTAAAT
GTTTCTTACTGTGTCAAGATTTCCCGTTGCGCTATCTTCCAAGACTACGTAATGCGTTTG
TCTCTCTATTCATGTTGTCTCTGTATAGGGGCACGGCGAATTCCTACTCCGTGTCTCTTC
TCCTATATCTTTACACCAAATTTGGCCCATTTTCATTCCCCTTTACGTAGTAGCGGTTTT
CGGCCTGCCGGTGCTACGCGTTTCTATAGCTAGTTTCGTTTTCTCACAAATAAATCCTAG
CAGGAGGAAAAGAAAGCGCAGGTTGAAACTCCGTTCAGAAGAAGAAAGCCACTCTTTGAA
AATACTGCCCACGCAATTGTCCCTTTCTGACAATAAGACCCCTTACTACTAGTAAATGTT
TTTATTCTCTAAGCTTCTTTTCCTCTAACTTCGACGCTAGAGCAGGCACTACCCTGTTGG
GCCGTACGTAACAACAACGACCCCTTATTTAGTCGAAGGGATCGCCAGAAACAGGGAGCA
AAAGATATTTAAGTGATGAGAATCAATTTCGATGATGATCACAAGCCAATGTTCTTTAAA
CTCAATTCTTGACTAATAAAAAAGCAGCTATCAACAAATTCATACTTTGAACAAGCTGAT
AAAAATAAGAAAACCATCGCATACACAAAATAAAATCAAC
Chr coordinates Chr VIII from 280820-281155
w3c xhtml validator w3c css validator