Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MSR1
Systematic Name YHR091C
Strain S288c
Description Mitochondrial arginyl-tRNA synthetase
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MSR1 YHR091C
TATTTCTTCTATTACGGTACTACCGTTTTCACTGCTGTCGGTTTGGAAGATTCTTTTGAA
ACTTCTATTGTCTTGGGTATTGTCAACTTTGCTTCCACCTTTGTTGGTATTTTCTTAGTC
GAAAGATATGGTCGTCGTAGATGTTTATTATGGGGTGCTGCTTCCATGACAGCTTGTATG
GTTGTTTTCGCTTCTGTTGGTGTTACAAGATTGTGGCCAAATGGTAAGAAGAACGGGTCT
TCTAAGGGTGCTGGTAACTGTATGATTGTCTTCACATGTTTCTACTTATTCTGTTTTGCC
ACTACCTGGGCTCCAATTCCATTTGTTGTTAACTCTGAAACTTTCCCATTGAGAGTTAAG
TCCAAGTGTATGGCTATTGCTCAAGCTTGTAACTGGATCTGGGGTTTCTTGATTGGTTTC
TTTACTCCATTTATTTCAGGTGCTATTGATTTCTACTACGGTTATGTTTTCATGGGCTGT
TTGGTCTTTTCTTACTTCTACGTCTTCTTCTTCGTTCCAGAAACTAAAGGTTTGACTTTA
GAAGAAGTTAACACCTTATGGGAAGAAGGTGTTTTGCCATGGAAATCACCTTCTTGGGTT
CCACCAAACAAGAGAGGTACTGACTACAACGCTGATGATCTAATGCATGATGATCAACCA
TTTTACAAGAAGATGTTCGGAAAAAAGTAGGTCAGTTAATTAAATAATATAGACTTCCTT
CAAGGAATAAAAATAATATTTGATCTTCAATTTTTAACGCTTTATGAAATATATATTTAT
GATTTAATAGTTTATAGATAATACTTTATCAAACTACAATTTTGAATTATGTTTTTTGTT
TCATAGTTCTGGAAGAGGTTAGGAATAGGCCGAATTCTCCACTTAACGATGGCAAAAGGT
CATCAATAAATACGACAAAAAAGACGTAAATACGTAGAACACAACTTTGATCTACCGTCA
ATCAAAAAGCTTTGAATGACCTACCTGAAAGTGGGTCAAT
Chr coordinates Chr VIII from 286770-284839
w3c xhtml validator w3c css validator