Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MSR1
Systematic Name YHR091C
Strain S288c
Description Mitochondrial arginyl-tRNA synthetase; mutations in human ortholog are associated with pontocerebellar hypoplasia type 6; MSR1 has a paralog, YDR341C, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MSR1 YHR091C
TATTTCTTCTATTACGGTACTACCGTTTTCACTGCTGTCGGTTTGGAAGATTCTTTTGAA
ACTTCTATTGTCTTGGGTATTGTCAACTTTGCTTCCACCTTTGTTGGTATTTTCTTAGTC
GAAAGATATGGTCGTCGTAGATGTTTATTATGGGGTGCTGCTTCCATGACAGCTTGTATG
GTTGTTTTCGCTTCTGTTGGTGTTACAAGATTGTGGCCAAATGGTAAGAAGAACGGGTCT
TCTAAGGGTGCTGGTAACTGTATGATTGTCTTCACATGTTTCTACTTATTCTGTTTTGCC
ACTACCTGGGCTCCAATTCCATTTGTTGTTAACTCTGAAACTTTCCCATTGAGAGTTAAG
TCCAAGTGTATGGCTATTGCTCAAGCTTGTAACTGGATCTGGGGTTTCTTGATTGGTTTC
TTTACTCCATTTATTTCAGGTGCTATTGATTTCTACTACGGTTATGTTTTCATGGGCTGT
TTGGTCTTTTCTTACTTCTACGTCTTCTTCTTCGTTCCAGAAACTAAAGGTTTGACTTTA
GAAGAAGTTAACACCTTATGGGAAGAAGGTGTTTTGCCATGGAAATCACCTTCTTGGGTT
CCACCAAACAAGAGAGGTACTGACTACAACGCTGATGATCTAATGCATGATGATCAACCA
TTTTACAAGAAGATGTTCGGAAAAAAGTAGGTCAGTTAATTAAATAATATAGACTTCCTT
CAAGGAATAAAAATAATATTTGATCTTCAATTTTTAACGCTTTATGAAATATATATTTAT
GATTTAATAGTTTATAGATAATACTTTATCAAACTACAATTTTGAATTATGTTTTTTGTT
TCATAGTTCTGGAAGAGGTTAGGAATAGGCCGAATTCTCCACTTAACGATGGCAAAAGGT
CATCAATAAATACGACAAAAAAGACGTAAATACGTAGAACACAACTTTGATCTACCGTCA
ATCAAAAAGCTTTGAATGACCTACCTGAAAGTGGGTCAAT
Chr coordinates Chr VIII from 286770-284839
w3c xhtml validator w3c css validator