Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name GGA2
Systematic Name YHR108W
Strain S288c
Description Protein that regulates Arf1p, Arf2p to facilitate Golgi trafficking; binds phosphatidylinositol 4-phosphate, which plays a role in TGN localization; has homology to gamma-adaptin; GGA2 has a paralog, GGA1, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GGA2 YHR108W
ATGGCAAATGGCATTGCTTCTATCAACTGTCTTGCATGTTCAACAGCGGCAGAATCTGGA
TTACTGCCACTTTTGGCATCTTCCTTAGAATCAGCGTCTAATGGAGGCGTGAAAATACGA
ATTTCTTGAGCTTCTATTACTTGCCTGATTCTGGACTTGAACTGTTGTAATTCTTGGGCA
GTCAATGTATCAGCTTTCGCAATAACTGGAATCAGATTGGCTCTGGTTGACAATCTCTTC
ATAGTCTCAATGTCAATTGGCTTTAAACCATGTCCAGTGGGCCTGATGAAGTACAGAACG
GCATGAACTCTCAAGTCAAATTTCTTAGTACGGTACGGTTGCTGCTCTTGACGCATATAA
GAATCGTGTTGATCATCAATAAAATCCACCAATGGTTGCCAGGCTTTGTTGTTATTCACG
TTATCTCCAAAACCTGGGGTGTCGATGACATTAACGCGTAATTCGAAATGCTTCTCTTCC
AGCAAAGCTCTTGTGATGTCGATTTCTACAGTCTTTCTGATGGGTTCTTGGCGGTGTTGC
TGACCATCTGCCCTTTTCAAGACAGTCTGAAATAAGGTATTAATAAATGTAGTTTTACCC
AATCCGCTCTCACCACATAACATCACGGTGAATGTACCACCTTCTTCATTAACAATTTTA
TAACGCTGGTTGGGAAGATTGGATATCCCTACAGGAGGAGGAACAGGGGCAGCAGTCGCA
GTGGCAGCACTCATTATTTGATACAATATGTGATGTAGTTCGTTATCAATACTCTTCAGG
TCAAGATCCTATATCTTGCTGCACCTTTCAAGACTTTGATCTACTCAAAACAAACAATGG
TGATTTCGAAAAAAATTTCGGATTCTTCACTTTTCCAGCGCCCTGTTTTTTTTCTGTAAT
CACGATTGCAAAAAAAAGAGACTTACCATAGGACAATTTCCATAAACAAAACAAAGAGCA
ACATAACTCATAGCTGAATTGCTAATCGTGATACTGCATC
Chr coordinates Chr VIII from 328303-330060
w3c xhtml validator w3c css validator