Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YHR112C
Systematic Name YHR112C
Strain S288c
Description Protein of unknown function; localizes to the cytoplasm and nucleus; overexpression affects protein trafficking through the endocytic pathway
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YHR112C YHR112C
AGAAATAGGCTTAATCCTTAATGCGGGGGAGTCGGTGTGAGCACCCGTAATGGCAATTGG
ATTACCAGGCTCCCACTTTCCACCAACAGCAAACGCAATAATGGAAGAGCCATTTCTTGT
CACAAAGTACTTTCCTTTTTGTGCGACGTGGCCAGCCCACGAGTCACGTTCGCTCAACTC
TTTGAAGCCATTTGACACCAGATGCTTTTTGATGTTATGAACTGTATGGTAAGGAGAGTG
TGAGCTATTTAAGAAACTGACAAACTCCTTTGGGTAATCACTCTTGCATGTTTTGCTGGA
CATAGTTCTCAGTTGTATCCTGAACATAGAAAAGCTGAACCTTTTATTCTTTCTTTTTAC
CTACTTGCTCACATAACATGAATTTTTTCTTTCATTCATACAGGAGGAAAACGCCCTTTT
TTCTTTCATTTAAGAGCGTGGAGATATCTGCAACTTTTCAGCAAGTATGATAAGGCTAAA
ATGATAAGGAATAGAAAACCGTAGCCAGAAACTAGTATCTCGAAAGCCAAGGCAGGCTTC
TGTTGCAAAAATAAGCAGACCTTAAACTAAAGGAGTTTACTCCTTGGCGGAACACTGAAT
CACATTATATACGTAAGTTGAACGGGACTATTTATCACGTGTGATTATGTGGTCTCCATG
TCAGTCGCAATATTTACAGTATATATAAGGGAAAGAGGGCCAGTTGTAATAATTGTAGTA
CGTGAAATAACTGTTTCTGAAGTCCTTCACATACGCTTTGGTACGGGATTAACCACTTAC
TGATAGACCTCAAGGATATCTTGTGAGTTCTTGTCAAATGGTGAAACTGTGGTTTCTATT
TTTTTGCGGTGTTTAATTCAGAGTGCGATCACTTGATGGGTTTATGCAACACGCGATATA
TAAGCATATTGCGCAACAATAGATCGTTGCAATCCCTCCATCTCTTCAAATGTTGTAGTA
CATGCTATAAAGGAAAGATTGCACGAAAAGAGTACGTAAG
Chr coordinates Chr VIII from 335663-334527
w3c xhtml validator w3c css validator