Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YHR112C
Systematic Name YHR112C
Strain S288c
Description Protein of unknown function; localizes to the cytoplasm and nucleus; overexpression affects protein trafficking through the endocytic pathway
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YHR112C YHR112C
AGAAATAGGCTTAATCCTTAATGCGGGGGAGTCGGTGTGAGCACCCGTAATGGCAATTGG
ATTACCAGGCTCCCACTTTCCACCAACAGCAAACGCAATAATGGAAGAGCCATTTCTTGT
CACAAAGTACTTTCCTTTTTGTGCGACGTGGCCAGCCCACGAGTCACGTTCGCTCAACTC
TTTGAAGCCATTTGACACCAGATGCTTTTTGATGTTATGAACTGTATGGTAAGGAGAGTG
TGAGCTATTTAAGAAACTGACAAACTCCTTTGGGTAATCACTCTTGCATGTTTTGCTGGA
CATAGTTCTCAGTTGTATCCTGAACATAGAAAAGCTGAACCTTTTATTCTTTCTTTTTAC
CTACTTGCTCACATAACATGAATTTTTTCTTTCATTCATACAGGAGGAAAACGCCCTTTT
TTCTTTCATTTAAGAGCGTGGAGATATCTGCAACTTTTCAGCAAGTATGATAAGGCTAAA
ATGATAAGGAATAGAAAACCGTAGCCAGAAACTAGTATCTCGAAAGCCAAGGCAGGCTTC
TGTTGCAAAAATAAGCAGACCTTAAACTAAAGGAGTTTACTCCTTGGCGGAACACTGAAT
CACATTATATACGTAAGTTGAACGGGACTATTTATCACGTGTGATTATGTGGTCTCCATG
TCAGTCGCAATATTTACAGTATATATAAGGGAAAGAGGGCCAGTTGTAATAATTGTAGTA
CGTGAAATAACTGTTTCTGAAGTCCTTCACATACGCTTTGGTACGGGATTAACCACTTAC
TGATAGACCTCAAGGATATCTTGTGAGTTCTTGTCAAATGGTGAAACTGTGGTTTCTATT
TTTTTGCGGTGTTTAATTCAGAGTGCGATCACTTGATGGGTTTATGCAACACGCGATATA
TAAGCATATTGCGCAACAATAGATCGTTGCAATCCCTCCATCTCTTCAAATGTTGTAGTA
CATGCTATAAAGGAAAGATTGCACGAAAAGAGTACGTAAG
Chr coordinates Chr VIII from 335663-334527
w3c xhtml validator w3c css validator