Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name DMA1
Systematic Name YHR115C
Alias CHF1
Strain S288c
Description Protein involved in ubiquitin ligation; plays a role in regulating spindle position and orientation; functionally redundant with Dma2p; orthologous to human RNF8 protein, also has sequence similarity to human Chfr.
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>DMA1 YHR115C
TTTTCGGCCATAAGAGCTTCTTATGTTCGGTATATACAAGTATGTAGAGATATATACAAA
AAATTCTTTATTCGCACTTTGAAAATCCAATTTAGCTTGCTTATTTACATACCATTGCGA
ATTAGTTTTTCACATTGCACTAGAGTGTGCTGTGGCTGCCTGTCGGAACACTACGTCGCG
TAGTGGCGATCTATATAGAAAACAGATCACAGCTGAACAAACAAGAAGAAAAGGCTGCCT
CATTCCCACTGCTGTCTGTTTTTCCTCCTGGCTGTCAGCCATTGTTTCTTGCATTCGCGG
TATGCGTCAAAATATTCTTGGCACTTGGATCGGTCGTAATCGTTGCGCTCGAGGCACTGA
AAACTGAGCTTGGAGGACTCCTCACAAGGATCATAGTACTGACTGTCAGCCTTTAACGCG
AATTTATACTTATTGACCGGGTTCTCCGGGTCGTCTGGGTAGTATTGAAATGACGACGGA
TCGTCGCTCTTTGGTACATAGTTGACTTTGGTTCTGTCCGTTACGGGTCCACTGGCCGCT
GGTGGCGTGGAAGACGAAGATGGTTGTGAATTGTTGCTGCTTGTAGAGCCACTGTTGGTA
TTTGTGGTATCCCTATTATCGTTGGTCATGGTCATACCGTTGGAGATAGTGGAGAGACTA
CTAGTTTGCCGCCTGGTGGGGCTGGGCTTCTCCATTCTCTTTAAGCGCTCTCGTGAGAGA
ATATCACTGTTTACGGCCCACAAAGAGAATGAGAAAATTGATAAACCTTAGCATTGGGAT
CAGCAGGAGCCTTAGAATTCTGGGTGTGAACAGAAACACATTAGTGCATTAGTGTATAGG
TTCGATATTATTCAAAGAGGAACTCGGTGTACGGCTCAACTGTAAACCGTACTTCTCGTT
CTTTGTTCACTGCCCTGTTTCTGACTCTTGTGCCGTGAGCTTTTCTTCTTACAGTGTCGA
TTTCCTGTGCACATACGTTCTGTATAGTGGTTATTCCTGG
Chr coordinates Chr VIII from 341359-340109
w3c xhtml validator w3c css validator