Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MSH1
Systematic Name YHR120W
Strain S288c
Description DNA-binding protein of the mitochondria involved in repair of mitochondrial DNA, has ATPase activity and binds to DNA mismatches; has homology to E. coli MutS; transcription is induced during meiosis
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MSH1 YHR120W
GGATAAATTAAAAATTAATTACCTACCCCATCGTCGCAGAGTTCACCAACCTTTAAATAC
GGTGAATATTCACAATGAAAGGAATGAGTACACACCTGAACTTTGTCAAAGAGAAGAATC
CTCGAATAAAGAACCTTCAGACTCAGTTCCTCAAGAAGTTTCATCCTCTAGAGATAATAG
GGCATCAAATAGAAGATTTCAGCAGGACATAGAGGCACAGAAAGCCGCAATTGGTACGGA
ATCTGAGCTGCTATCACTAAATCAATTAAATAAAAGAAAAAAGCCAGTTATGTTCGCTCG
TTCAGCAATTCACAACTGGGGTTTATATGCTCTAGACTCTATCGCAGCAAAGGAAATGAT
TATCGAGTACGTTGGTGAAAGGATCAGGCAACCTGTAGCAGAAATGAGAGAGAAAAGATA
TCTGAAAAATGGGATTGGATCCAGTTACCTTTTTAGGGTTGATGAAAACACGGTTATTGA
TGCCACCAAGAAAGGTGGTATAGCCCGTTTCATTAATCATTGTTGTGATCCAAATTGTAC
GGCAAAGATTATAAAGGTTGGCGGGAGAAGGAGAATTGTTATCTATGCACTGCGTGATAT
CGCGGCAAGCGAAGAGTTGACATATGATTACAAATTTGAGAGAGAAAAGGATGACGAGGA
AAGACTTCCTTGTTTATGTGGAGCACCTAATTGTAAAGGTTTCTTGAACTGACGATGATA
CATTGATTTGTTTGGAGCTTCCTGATTTAACATATCGTTGCTTTCCAGCAAAAGGTAAAG
ATAAATACTAAACTGTATACATCTATAAGTAATCTCGGCCATTATTTTAACGATTAGTAC
TTTTGTTCGTGTCATTTTTTTGGAAAATTTTGCGATCTCTCACTGTTGAAGAATAAAGAT
TTCGCGATGACTTTTGCTTGCAGAGAAATGCCTGAAAACACGAACATTCAATAATATAGA
TGGTACATAACATATGCGCAAGAAAACGTAAAGGCCACGG
Chr coordinates Chr VIII from 349574-352453
w3c xhtml validator w3c css validator