Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YCK1
Systematic Name YHR135C
Alias CKI2
Strain S288c
Description Palmitoylated plasma membrane-bound casein kinase I (CK1) isoform; shares redundant functions with Yck2p in morphogenesis, proper septin assembly, endocytic trafficking, and glucose sensing; stabilized by Sod1p binding in the presence of glucose and oxygen, causing glucose repression of respiratory metabolism; involved in the phosphorylation and regulation of glucose sensor Rgt2p; YCK1 has a paralog, YCK2, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YCK1 YHR135C
CAATTACAACTACAACGCCGTAAAGTTCCAAACGCAGCGGCCTGAGATAGTAAATGATGT
ACGCACGTGGGCGAAAGTTCATTACTTTGACTGTTGTAACATACCGTATCTCTCTTTTCC
CACGTGCTCCGCTCTCTTATCTACCTTGGCGGTACAGCCCTGCGCGGAGTCACTGCAGCC
ACGTGCCTAGATCTATTACTATGACTTCCCATGGGCACATATACGCCATTAATATACAAT
ATATATAACGTTCATATATGGGTATTTACAGAGAGCCAGGGGCAAATTGGACAGATGTCT
CCACGCGGCAAAATGGAAACAGCAGTTTCACAAGGACAACACAAACAACTTAAAGATGGT
CACCAGCATAAGGGAAGAAAACTCTCCGAGGAGATCGCTTCTCTATTGAGGCTCAAAGAG
TGCAGGAGGCTCAATCCTGCTAGTTACTATACTCCACGTAGAACATCGCAGTCACAATCT
CTCAGTGGATCAACTTTTAAAGAGTATAACGAGTACATTAATGAGAAAGATTCAAGTAGA
GCGCAGCGTCAAAACGCTGCCGCCGTTTTAAGCAAGCTCGCCCATGACTTTTGGGAGAAC
GACTGTGTCATTGACGAAGACATATTCGAAGATTCGTCTGACGAAGAACAATCATGATTG
CATCTCTTAATCGTTACACATACATACCTTCTACCTCTGTACTGTTACATATGCATTGAC
TTTACGATCTAATATAAATCCTTTTGATGTTACCCCGCCTGTGGGCTCGTTCTCCTTTCG
TTTCTTACGATTTTTTCGCCGGAACAAGAAAAAACAGAACAAAACAAATCAGCGATCGTA
TACATGGGTCTTTGATTTCTGCTTGCTTCTTACAAACAACAAACGCAAACCGTTCATTGA
GTGCTCTGTGACTGGTTTTCATGTGGATGCCATAGTAGAGAAAAGACACATACAAAAATT
TCGCGCATTCGCTGGCCCTTTTCCTGCTCTCCTCTTCCCC
Chr coordinates Chr VIII from 374310-372694
w3c xhtml validator w3c css validator